Associations of renin-angiotensin system genetic polymorphisms and clinical course after aneurysmal subarachnoid hemorrhage

View More View Less
  • 1 Beth Israel Deaconess Medical Center, Harvard Medical School;
  • | 4 Harvard Medical School, Boston, Massachusetts;
  • | 2 Children's of Alabama;
  • | 3 Department of Neurosurgery, University of Alabama at Birmingham, Alabama;
  • | 5 Department of Neurosciences and
  • | 7 Inova Translational Medicine Institute, Inova Health System, Falls Church; and
  • | 6 Department of Molecular Neuroscience, George Mason University, Fairfax, Virginia
Full access

OBJECTIVE

Renin-angiotensin system (RAS) genetic polymorphisms are thought to play a role in cerebral aneurysm formation and rupture. The Cerebral Aneurysm Renin Angiotensin System (CARAS) study prospectively evaluated associations of common RAS polymorphisms and clinical course after aneurysmal subarachnoid hemorrhage (aSAH).

METHODS

The CARAS study prospectively enrolled aSAH patients at 2 academic centers in the United States. A blood sample was obtained from all patients for genetic evaluation and measurement of plasma angiotensin converting enzyme (ACE) concentration. Common RAS polymorphisms were detected using 5′exonuclease genotyping assays and pyrosequencing. Analysis of associations of RAS polymorphisms and clinical course after aSAH were performed.

RESULTS

A total of 166 patients were screened, and 149 aSAH patients were included for analysis. A recessive effect of allele I (insertion) of the ACE I/D (insertion/deletion) polymorphism was identified for Hunt and Hess grade in all patients (OR 2.76, 95% CI 1.17–6.50; p = 0.0206) with subsequent poor functional outcome. There was a similar effect on delayed cerebral ischemia (DCI) in patients 55 years or younger (OR 3.63, 95% CI 1.04–12.7; p = 0.0439). In patients older than 55 years, there was a recessive effect of allele A of the angiotensin II receptor Type 2 (AT2) A/C single nucleotide polymorphism (SNP) on DCI (OR 4.70, 95% CI 1.43–15.4; p = 0.0111).

CONCLUSIONS

Both the ACE I/D polymorphism and the AT2 A/C single nucleotide polymorphism were associated with an age-dependent risk of delayed cerebral ischemia, whereas only the ACE I/D polymorphism was associated with poor clinical grade at presentation. Further studies are required to elucidate the relevant pathophysiology and its potential implication in the treatment of patients with aSAH.

ABBREVIATIONS

ACE = angiotensin-converting enzyme; AGT = angiotensinogen; aSAH = aneurysmal subarachnoid hemorrhage; AT1 = angiotensin II receptor Type 1; AT2 = angiotensin II receptor Type 2; CARAS = Cerebral Aneurysm Renin Angiotensin System; CTA = CT angiography; DCI = delayed cerebral ischemia; DSA = digital subtraction angiography; eNOS = endothelial nitric oxide synthase; FDR = false discovery rate; HWE = Hardy-Weinberg equilibrium; mRS = modified Rankin Scale; PCR = polymerase chain reaction; RAS = renin-angiotensin system; SNP = single nucleotide polymorphism; VSMC = vascular smooth muscle cell.

OBJECTIVE

Renin-angiotensin system (RAS) genetic polymorphisms are thought to play a role in cerebral aneurysm formation and rupture. The Cerebral Aneurysm Renin Angiotensin System (CARAS) study prospectively evaluated associations of common RAS polymorphisms and clinical course after aneurysmal subarachnoid hemorrhage (aSAH).

METHODS

The CARAS study prospectively enrolled aSAH patients at 2 academic centers in the United States. A blood sample was obtained from all patients for genetic evaluation and measurement of plasma angiotensin converting enzyme (ACE) concentration. Common RAS polymorphisms were detected using 5′exonuclease genotyping assays and pyrosequencing. Analysis of associations of RAS polymorphisms and clinical course after aSAH were performed.

RESULTS

A total of 166 patients were screened, and 149 aSAH patients were included for analysis. A recessive effect of allele I (insertion) of the ACE I/D (insertion/deletion) polymorphism was identified for Hunt and Hess grade in all patients (OR 2.76, 95% CI 1.17–6.50; p = 0.0206) with subsequent poor functional outcome. There was a similar effect on delayed cerebral ischemia (DCI) in patients 55 years or younger (OR 3.63, 95% CI 1.04–12.7; p = 0.0439). In patients older than 55 years, there was a recessive effect of allele A of the angiotensin II receptor Type 2 (AT2) A/C single nucleotide polymorphism (SNP) on DCI (OR 4.70, 95% CI 1.43–15.4; p = 0.0111).

CONCLUSIONS

Both the ACE I/D polymorphism and the AT2 A/C single nucleotide polymorphism were associated with an age-dependent risk of delayed cerebral ischemia, whereas only the ACE I/D polymorphism was associated with poor clinical grade at presentation. Further studies are required to elucidate the relevant pathophysiology and its potential implication in the treatment of patients with aSAH.

ABBREVIATIONS

ACE = angiotensin-converting enzyme; AGT = angiotensinogen; aSAH = aneurysmal subarachnoid hemorrhage; AT1 = angiotensin II receptor Type 1; AT2 = angiotensin II receptor Type 2; CARAS = Cerebral Aneurysm Renin Angiotensin System; CTA = CT angiography; DCI = delayed cerebral ischemia; DSA = digital subtraction angiography; eNOS = endothelial nitric oxide synthase; FDR = false discovery rate; HWE = Hardy-Weinberg equilibrium; mRS = modified Rankin Scale; PCR = polymerase chain reaction; RAS = renin-angiotensin system; SNP = single nucleotide polymorphism; VSMC = vascular smooth muscle cell.

The renin-angiotensin system (RAS) plays a crucial role in physiological vasorelaxation/vasoconstriction of the cerebral vasculature, vascular remodeling, and maintenance of arterial wall integrity.2,9,14 Compared with the normal arterial wall, cerebral aneurysms, in particular ruptured aneurysms, express significantly less angiotensin-converting enzyme (ACE) and angiotensin II receptor Type 1 (AT1), resulting in lack of vascular remodeling and thinning of the arterial wall under hemodynamic stress.23 Certain RAS genetic polymorphisms have been linked to aneurysmal subarachnoid hemorrhage (aSAH). In a meta-analysis, the II genotype of the ACE insertion/deletion (I/D) polymorphism was associated with aSAH (OR 1.64, 95% CI 1.24–2.17; p = 0.009) compared with controls.24 In the Cerebral Aneurysm Renin Angiotensin System (CARAS) study, allele C of the X-linked angiotensin II receptor Type 2 (AT2) A/C single nucleotide polymorphism (SNP) demonstrated a dominant effect on aSAH (OR 3.48, 95% CI 1.23–9.84; p = 0.0192) (Griessenauer et al., unpublished data, 2016). The significance of RAS genetic polymorphisms on the clinical course of aSAH, however, has not been studied. We sought to evaluate the association between common RAS polymorphisms of angiotensinogen (AGT), ACE, AT1, AT2, and clinical course after aSAH.

Methods

Study Design

A prospective trial evaluating the role of common RAS genetic polymorphisms in aSAH was performed at 2 academic institutions in the United States from September 2012 to January 2015. The study group included all patients who presented with aSAH. The diagnosis of SAH was established by admission CT scan or xanthochromia of cerebrospinal fluid (CSF). A ruptured cerebral aneurysm was confirmed by CT angiography (CTA) or digital subtraction angiography (DSA). Exclusion criteria were age younger than 19 years and any associated genetic syndrome that could explain the presence of a cerebral aneurysm (such as polycystic kidney disease, Ehler-Danlos syndrome Type 4, and Marfan syndrome) or systemic diseases (e.g., congestive heart failure and cirrhosis) that could interfere with RAS activity. All patients were enrolled within 72 hours of admission.

General Management

Patients presenting with aSAH were treated in accordance with contemporary standards of care in the United States: ICU monitoring, treatment of hydrocephalus, early (< 48 hours) intervention for aneurysm treatment, oral nimodipine, maintenance of euvolemia, and surveillance for clinical vasospasm and delayed cerebral ischemia (DCI).6 Following discharge from the ICU, patients are transferred to a ward with personnel trained in managing aSAH patients.

Definition of Clinical Vasospasm and DCI

Clinical vasospasm was defined as a new focal or global neurological deficit, or deterioration of at least 2 points on the Glasgow Coma Scale that is not explained by another clinical process including hydrocephalus, aneurysm rerupture, electrolyte disturbance, seizure, infection, fever, metabolic disturbance, cerebral edema, or surgical complication. Corroborating evidence of angiographic vasospasm was defined as arterial narrowing on CTA or DSA not due to atherosclerosis, catheter-induced vasospasm, or vessel hypoplasia. Additionally, vasospasm was diagnosed using transcranial Doppler ultrasound findings of a peak systolic middle cerebral artery of > 120 cm/sec with a Lindegaard ratio of > 3. CTA, DSA, and transcranial Doppler ultrasonography were performed at the discretion of the treating neurosurgeon. The diagnosis of clinical vasospasm was adjudicated by consensus of the study team and treated with hyperdynamic therapy as first line.7 Hyperdynamic therapy included avoidance of hypovolemia with a goal systolic blood pressure of greater than 160 mm Hg, accomplished with either permissive hypertension or vasopressor therapy. Patients with clinical vasospasm refractory to medical treatment were treated in the endovascular suite at the discretion of the treating neurosurgeon.

CT scanning or MRI was routinely performed when the patient was transferred from the ICU to the ward. DCI was defined as low-density areas on CT that corresponded to a vascular distribution or an MR image demonstrating a hyperintense area on a diffusion-weighted imaging sequence with a corresponding hypointense apparent diffusion coefficient sequence correlate that corresponded with a vascular territory. Infarctions or contusions seen on postoperative Day 1 imaging were considered procedurally related and were not considered DCI.

Outcome Measures in aSAH Patients

Outcome measures included clinical vasospasm, DCI, mortality, and functional outcome at the time of discharge from the acute hospital setting, at 12 months, and at last follow-up using the modified Rankin Scale (mRS). Poor outcome was defined as death or severe disability (mRS Score 4–6). All outcome data were obtained blinded to the results of the genetic analysis. Functional outcome was assessed either in the clinic or via telephone interview with the patient or with a surrogate if the patient was unable to participate.3

Laboratory and Genetic Evaluation

A blood sample was obtained from all patients within 72 hours of admission for genetic evaluation and measurement of plasma ACE concentration. Common RAS genetic polymorphisms were detected using 5′exonuclease (TaqMan) genotyping assays (SNPs AGT C/T [rs699], AT1 A/C [rs5186], AT2 A/C [rs11091046], and G/A [rs1403543]) and restriction fragment length polymorphism analysis (ACE I/D [rs4340]). Commercial TaqMan assays were designed and performed according to the vendor (Thermo Fisher Scientific Inc.). Approximately 10% of the DNA samples were randomly selected to test reproducibility of TaqMan assays. All of the replication samples produced concordant genotypes. For the ACE I/D polymorphism, a polymerase chain reaction (PCR)–based gel assay was used for the first round of genotyping with a second-round replication performed using an amplification reaction containing 5 ng/μl of genomic DNA, 2 μM of forward and reverse primers in a FailSafe Premix B 1× reaction (Epicentre). PCRs were performed in a C100 Touch Thermocycler (Bio-Rad), using cycling conditions as follows: 30 cycles with denaturation at 94°C for 1 minute, annealing at 58°C for 1 minute, and extension at 72°C for 2 minutes. PCR primers were as follows: forward primer, sense oligo 5′CTGGAGACCACTCCCATCCTTCT3′; reverse primer, 5′GATGTGGCCATCACATTCGTCAGAT3′. PCR products were resolved using the QIAxcel system (QIAGEN) to discriminate 490 bp (insertion) from 202 bp (deletion) alleles.

Statistical Analysis

Genotype frequencies for the individual SNPs and the ACE I/D were analyzed for all patients and then by age (patients ≤ 55 years or > 55 years; 55 years was the median age in the cohort). Sample size calculation was performed. Assuming a 50% rate of clinical vasospasm, with an alpha of 0.05 and power of 90%, a total sample size of 146 is needed to detect genotype associated with a 25% rate of vasospasm. Hardy-Weinberg equilibrium (HWE) was assessed using the chi-square test in aSAH patients and controls separately. To identify potential confounding variables, we tested for associations between patient characteristics, outcome measures, and genotype. Categorical variables and numerical variables were compared using Fisher's exact test and 1-way ANOVA, respectively. The association of genotype and outcome measures was tested using binary logistic regression with a standard method for dominant and recessive models. Multivariate logistic regression was subsequently performed to control for race and hypertension for all comparisons with p < 0.1. Adjustment of the false discovery rate (FDR) associated with multiple comparisons was performed using the Benjamini-Hochberg procedure.1 The FDR was set to 10%. Unless specifically indicated, associations were not statistically significant after FDR correction.

Results

Between September 2012 and February 2015, 166 aSAH patients were screened for inclusion. Nine patients who were screened were excluded. A total of 157 aSAH patients were enrolled. One aSAH patient withdrew from the study, and blood samples of 7 aSAH patients could not be processed (Fig. 1).

FIG. 1.
FIG. 1.

Flowchart of participant enrollment.

Patient Characteristics and Outcome Measures

The mean age of aSAH patients was 54.9 ± 12.5 years (male/female ratio 1:3.26). The majority (62.4%) of ruptured aneurysms were smaller than 7 mm in size and were located in the anterior circulation (80.5%). Favorable Hunt and Hess Grades I–III and Fisher CT Grades 1 and 2 were present in 77.2% and 15.4% of patients, respectively. Microsurgical clipping and endovascular treatment were performed in 52.4% and 47.6%, respectively, and 4.7% of patients experienced rerupture of the aneurysm prior to treatment. Clinical vasospasm, DCI, and poor functional outcome at last follow-up occurred in 22.8%, 21.2%, and 19.5% of patients, respectively (Table 1).

TABLE 1.

Patient characteristics and outcome measures in 149 patients with aSAH

VariableValue*
Patient characteristics
  Mean age in yrs54.9 ± 12.5
  Race
    White85 (57.0)
    African American60 (40.3)
    Other4 (2.7)
  Sex
    Male35 (23.5)
    Female114 (76.5)
  Ischemic vascular disease13 (8.7)
  Hypertension90 (60.4)
  ACE inhibitor or ARB42 (28.2)
  Smoker
    Never58 (38.9)
    Former18 (12.1)
    Current73 (49.0)
  Unruptured aneurysm(s)32 (21.5)
  Family history of intracranial aneurysms14 (9.4)
  Aneurysm size in mm
    <793 (62.4)
    7–1249 (32.9)
    13–246 (4.0)
    ≥251 (0.7)
  Location
    Anterior120 (80.5)
    Posterior29 (19.5)
  Hunt & Hess grade
    I–III115 (77.2)
    IV & V34 (22.8)
  Fisher grade
    1–223 (15.4)
    3–4126 (84.6)
  Treatment
    Microsurgical clipping76 (52.4)
    Endovascular treatment69 (47.6)
  Rerupture7 (4.7)
Outcome measures
  Clinical vasospasm34 (22.8)
  DCI31 (21.2)
  Mean ICU stay in days11.9 ± 7.9
  Mean hospital stay in days15.9 ± 11.3
  Discharge mRS score
    0–392 (61.7)
    4–657 (38.3)
  mRS score at last follow-up
    0–3120 (80.5)
    4–629 (19.5)
  Mean length of follow-up in days249.7 ± 187.8

ARB = angiotensin receptor blocker.

Values are presented as the number of patients (%) unless noted otherwise. Mean values are presented as the mean ± SD.

Data were not available for 4 aneurysms.

Data were not available for 3 aneurysms.

Association of RAS Polymorphisms and Clinical Course

Genotype frequencies of the individual SNPs and ACE I/D polymorphism were found to be in HWE. The X-linked AT2 SNPs were in HWE in males and females.

Angiotensinogen C/T Polymorphism (rs699)

Univariable analysis showed statistically significant associations of genotype with race (p < 0.0001) that persisted after FDR correction. The association with aneurysm size (p = 0.0226) was not significant after FDR correction (Table 2). In patients older than 55 years of age, genotype was associated with clinical vasospasm (p = 0.0369) and DCI (p = 0.0173); however, this was not significant after FDR correction (Table 3).

TABLE 2.

Patient demographics and characteristics by AGT C/T (rs699), ACE I/D (rs4340), and AT 1 A/C (rs5186) genotype*

VariableAGT C/T (rs699)ACE I/D (rs4340)AT1 A/C (rs5186)
CC (n = 58)CT (n = 60)TT (n = 31)p ValueDD (n = 52)I/D (n = 66)II (n = 31)p ValueAA (n = 93)AC (n = 49)CC (n = 7)p Value
HWEp = 0.0412p = 0.241p = 0.867
Mean age in yrs53.7 ± 13.755.4 ± 12.256.1 ± 10.80.64853.2 ± 12.756.2 ± 13.054.7 ± 11.00.43554.6 ± 12.254.5 ± 12.661.4 ± 15.90.366
Race<0.00010.376<0.0001
  White11 (19.0)45 (75.0)29 (93.5)26 (50.0)40 (60.6)19 (61.3)36 (38.7)42 (85.7)7 (100.0)
  African American44 (75.9)14 (23.3)2 (6.5)25 (48.1)25 (37.9)10 (32.3)55 (59.1)5 (10.2)0 (0.0)
  Other3 (5.2)1 (1.7)0 (0.0)1 (1.9)1 (1.5)2 (6.5)2 (2.2)2 (4.1)0 (0.0)
Sex0.1890.3760.373
  Male13 (22.4)11 (18.3)11 (35.5)11 (21.2)19 (28.8)5 (16.1)24 (25.8)11 (22.4)0 (0.0)
  Female45 (77.6)49 (81.7)20 (64.5)41 (78.8)47 (71.2)26 (83.9)69 (74.2)38 (77.6)7 (100.0)
Ischemic vascular disease5 (8.6)6 (10.0)2 (6.5)0.9334 (7.7)7 (10.6)2 (6.5)0.80611 (11.8)1 (2.0)1 (14.3)0.0730
Hypertension40 (69.0)34 (56.7)16 (51.6)0.20934 (65.4)38 (57.6)18 (58.1)0.67559 (63.4)27 (55.1)4 (57.1)0.617
Mean ACE level24.0 ± 13.023.3 ± 12.420.8 ± 12.40.56626.6 ± 14.222.5 ± 12.117.6 ± 8.00.0195
Smoker0.2690.9760.759
  Never24 (41.4)21 (35.0)13 (41.9)21 (40.4)24 (36.4)13 (41.9)36 (38.7)18 (36.7)4 (27.1)
  Former3 (5.2)11 (18.3)4 (12.9)6 (11.5)8 (12.1)4 (12.9)12 (12.9)5 (10.2)1 (14.3)
  Current31 (53.4)28 (46.7)14 (45.2)25 (48.1)34 (51.5)14 (45.2)45 (48.4)26 (53.1)2 (28.6)
Family history5 (8.6)8 (13.3)1 (3.2)0.3195 (9.6)6 (9.1)3 (9.7)19 (9.7)5 (10.2)0 (0.0)1
Aneurysm size0.02260.9970.373
  <7 mm44 (75.9)32 (53.4)17 (54.8)33 (63.5)41 (62.1)19 (61.3)61 (65.6)27 (55.1)5 (71.4)
  7–12 mm10 (17.2)26 (43.3)13 (41.9)17 (32.7)21 (31.8)11 (35.5)28 (30.1)20 (40.8)1 (14.3)
  13–24 mm3 (5.2)2 (3.3)1 (3.2)2 (3.8)3 (4.5)1 (3.2)3 (3.2)2 (4.1)1 (14.3)
  ≥25 mm1 (1.7)0 (0.0)0 (0.0)0 (0.0)1 (1.5)0 (0.0)1 (1.1)0 (0.0)0 (0.0)
Location10.7690.552
  Anterior47 (81.0)48 (80.0)25 (80.6)40 (76.9)54 (81.8)26 (83.9)77 (82.8)38 (77.6)5 (71.4)
  Posterior11 (19.0)12 (20.0)6 (19.4)12 (23.1)12 (18.2)5 (16.1)16 (17.2)11 (22.4)2 (28.6)
Hunt & Hess grade0.1440.06820.743
  I–III45 (77.6)50 (83.3)20 (64.5)43 (82.7)53 (80.3)19 (61.3)73 (78.5)37 (75.5)5 (71.4)
  IV & V13 (22.4)10 (16.7)11 (35.5)9 (17.3)13 (19.7)12 (38.7)20 (21.5)12 (24.5)2 (28.6)
Fisher grade0.8380.1860.373
  1 & 210 (17.2)8 (13.3)5 (16.1)12 (23.1)8 (12.1)3 (9.7)15 (16.1)6 (12.2)2 (28.6)
  3 & 448 (82.8)52 (86.7)26 (83.9)40 (76.9)58 (87.9)28 (90.3)78 (83.9)43 (87.8)5 (71.4)
Treatment§0.6940.07430.0334
  Clipping28 (49.1)30 (52.6)18 (58.1)32 (64.0)32 (50.0)12 (38.7)52 (57.8)19 (38.8)5 (83.3)
  Endovascular29 (50.9)27 (47.4)13 (41.9)18 (36.0)32 (50.0)19 (61.3)38 (42.2)30 (61.2)1 (16.7)
Rerupture0 (0.0)4 (6.7)3 (9.7)0.04651 (1.9)4 (6.1)2 (6.5)0.5395 (5.4)1 (2.0)1 (14.3)0.273

Values indicate number of patients (%) unless specified otherwise. Mean values are presented as the mean ± SD.

Significant after FDR correction.

Data were not available for 28 aneurysms.

Data were not available for 4 aneurysms.

TABLE 3.

Outcome measures by AGT C/T (rs699), ACE I/D (rs4340), and AT1 A/C (rs5186) genotype for all patients, patients older than 55 years, and patients 55 years or younger*

Age Group & VariableAGT C/T (rs699)ACE I/D (rs4340)AT1 A/C (rs5186)
CCCTTTp ValueDDI/DIIp ValueAAACCCp Value
All patients
  No. of patients58603152663193497
  Clinical vasospasm10 (17.2)14 (23.3)10 (32.3)0.2739 (17.3)15 (22.7)10 (32.3)0.29121 (22.6)13 (26.5)0 (0.0)0.367
  DCI7 (12.3)14 (24.1)10 (32.3)0.12210 (19.6)11 (17.2)10 (32.3)0.25719 (20.9)11 (22.4)1 (16.7)0.301
  Mean ICU stay in days11.8 ± 6.511.9 ± 9.511.9 ± 6.8110.5 ± 5.713.4 ± 9.311.0 ± 7.40.11512.0 ± 8.012.4 ± 8.06.7 ± 2.80.200
  Mean hospital stay in days16.1 ± 9.615.8 ± 13.715.7 ± 9.10.98414.0 ± 7.518.3 ± 13.813.8 ± 9.70.065416.2 ± 12.216.3 ± 9.88.1 ± 3.00.180
  Discharge mRS score0.9100.3880.917
    0–337 (63.8)37 (61.7)18 (58.1)35 (67.3)41 (62.1)16 (51.6)57 (61.3)30 (61.2)5 (71.4)
    4–621 (36.2)23 (38.3)13 (41.9)17 (32.7)25 (37.9)15 (48.4)36 (38.7)19 (38.8)2 (28.6)
  mRS score at last follow-up0.6200.1290.669
    0–348 (82.8)49 (81.7)23 (74.2)45 (86.5)54 (81.8)21 (67.7)74 (79.6)41 (83.7)5 (71.4)
    4–610 (17.2)11 (18.3)8 (25.8)7 (13.5)12 (18.2)10 (32.3)19 (20.4)8 (16.3)2 (28.6)
Mean length of follow-up in days248 ± 201258 ± 181237 ± 1810.880276 ± 180243 ± 194219 ± 1880.373238 ± 185268 ± 193269 ± 2000.642
≤55 yrs
  No. of patients33271327311548232
  Clinical vasospasm8 (24.2)4 (14.8)3 (23.1)0.6874 (14.8)5 (16.1)6 (40.0)0.15611 (22.9)4 (8.3)0 (0.0)0.849
  DCI6 (18.2)6 (22.2)6 (46.2)0.8646 (22.2)3 (9.7)6 (40.0)0.057312 (25.0)3 (13.0)0 (0.0)0.595
  Mean ICU stay in days10.6 ± 4.710.3 ± 7.812.0 ± 5.20.6999.8 ± 4.211.9 ± 9.511.9 ± 6.8111.3 ± 6.810.0 ± 4.57.5 ± 2.10.533
  Mean hospital stay14.6 ± 7.012.5 ± 7.616.5 ± 9.20.28413.4 ± 6.315.8 ± 13.715.7 ± 9.10.98415.0 ± 8.612.8 ± 5.38.5 ± 0.70.305
  Discharge mRS score0.6990.6320.455
    0–324 (72.7)20 (74.1)8 (66.7)18 (66.7)24 (77.4)10 (66.7)33 (68.8)18 (78.3)1 (50.0)
    4–69 (27.3)7 (25.9)5 (41.7)9 (33.3)7 (22.6)5 (33.3)15 (31.3)5 (21.7)1 (50.0)
  mRS score at last follow-up0.33510.0374
    0–330 (90.9)25 (92.6)10 (76.9)24 (88.9)28 (90.3)13 (86.7)41 (85.4)23 (100.0)1 (50.0)
    4–63 (9.1)2 (7.4)3 (23.1)3 (11.1)3 (9.7)2 (13.3)7 (14.6)0 (0.0)1 (50.0)
  Mean length of follow-up in days267 ± 226246 ± 172198 ± 1760.570294 ± 209258 ± 181237 ± 1810.880224 ± 190303 ± 209133 ± 1880.207
>55 yrs
  No. of patients25331825351645265
  Clinical vasospasm2 (8.0)10 (30.3)7 (38.9)0.03695 (20.0)10 (28.6)4 (25.0)0.74210 (22.2)9 (34.6)0 (0.0)0.236
  DCI1 (4.2)8 (25.8)7 (38.9)0.01734 (16.7)8 (24.2)4 (25.0)0.1227 (16.3)8 (30.8)1 (25.0)0.314
  Mean ICU stay in days13.4 ± 8.113.2 ± 10.711.8 ± 7.90.82811.2 ± 7.011.9 ± 9.511.9 ± 6.8112.7 ± 9.014.5 ± 9.86.4 ± 3.20.188
  Mean hospital stay in days18.1 ± 12.018.4 ± 16.915.1 ± 9.20.69714.6 ± 8.815.8 ± 13.715.7 ± 9.10.98417.5 ± 15.219.4 ± 11.78.0 ± 3.70.238
  Discharge mRS score10.1570.407
    0–313 (52.0)17 (51.5)10 (55.6)17 (68.0)17 (48.6)6 (37.5)24 (53.3)12 (46.2)4 (80.0)
    4–612 (48.0)16 (48.5)8 (44.4)8 (32.0)18 (51.4)10 (62.5)21 (46.7)14 (53.8)1 (20.0)
  mRS score at last follow-up10.6200.917
    0–318 (72.0)24 (72.7)13 (72.2)21 (84.0)26 (74.3)8 (50.0)33 (73.3)18 (69.2)4 (80.0)
    4–67 (28.0)9 (27.3)5 (27.8)4 (16.0)9 (25.7)8 (50.0)12 (26.7)8 (30.8)1 (20.0)
  Mean length of follow-up in days224 ± 163268 ± 190265 ± 1840.625257 ± 143258 ± 181237 ± 1810.880254 ± 182237 ± 175324 ± 1950.620

Values represent number of patients (%) unless noted otherwise. Mean values are presented as the mean ± SD.

Data were not available for 3 aneurysms.

In logistic regression, there was a statistically significant recessive effect of the C allele (CC vs CT + TT) on aneurysm size (< 7 mm vs ≥ 7 mm) (OR 2.63, 95% CI 1.06–6.51; p = 0.0367) after controlling for race and performing FDR correction (Table 4). There was also a non-significant dominant effect of the T allele (CC vs CT + TT) on clinical vasospasm (OR 4.62, 95% CI 0.719–29.7; p = 0.107) and DCI (OR 9.54, 95% CI 0.878–105; p = 0.0651) in patients older than 55 years after controlling for race and hypertension (Table 4).

TABLE 4.

Dominant and recessive effects of RAS polymorphisms on neurological status at presentation and outcome measures in aSAH

PolymorphismOutcomeAgeEffectOR (95% CI)p Value*
AGT G/A (rs699)Aneurysm size <7 mmAll patientsRecessive effect of the C allele (CC vs CT + TT)2.69 (1.86–3.91)0.0077
AGT G/A (rs699)Clinical vasospasm>55 yrsDominant effect of the T allele (TT + CT vs CC)5.75 (1.21–27.4)0.0278
AGT G/A (rs699)DCI>55 yrsDominant effect of the T allele (TT + CT vs CC)10.1 (1.25–82.0)§0.0300
ACE I/D (rs4340)Hunt & Hess gradeAll patientsRecessive effect of the I allele (II vs ID + DD)2.76 (1.17–6.50)0.0206
ACE I/D (rs4340)mRS score at last follow-upAll patientsRecessive effect of the I allele (II vs ID + DD)2.48 (1.01–6.10)0.0475
ACE I/D (rs4340)Hunt & Hess grade>55 yrsRecessive effect of the I allele (II vs ID + DD)4.00 (1.25–12.8)0.0198
ACE I/D (rs4340)mRS score at last follow-up>55 yrsRecessive effect of the I allele (II vs ID + DD)3.61 (1.14–11.5)**0.0294
ACE I/D (rs4340)Clinical vasospasm≤55 yrsRecessive effect of the I allele (II vs ID + DD)3.63 (1.04–12.7)0.0439
ACE I/D (rs4340)DCI≤55 yrsRecessive effect of the I allele (II vs ID + DD)3.63 (1.04–12.7)0.0439
AT2 A/C (rs11091046)Clinical vasospasm>55 yrsRecessive effect of the A allele (XAXA + XAY vs XAXC + XCXC + XCY)3.04 (0.990–9.30)0.0523
AT2 A/C (rs11091046)DCI>55 yrsRecessive effect of the A allele (XAXA + XAY vs XAXC + XCXC + XCY)4.70 (1.43–15.4)0.0111

p values significant after FDR correction.

After adjusting for race, OR 2.63, 95% CI 1.06–6.51; p = 0.0367, statistically significant.

After adjusting for race and hypertension, OR 4.62, 95% CI 0.719–29.7; p = 0.107.

After adjusting for race and hypertension, OR 9.54, 95% CI 0.878–105; p = 0.0651.

After adjusting for Hunt and Hess grade, OR 1.54, 95% CI 0.498–4.74; p = 0.455.

After adjusting for Hunt and Hess grade, OR 2.12, 95% CI 0.519–8.71; p = 0.295.

Angiotensin Converting Enzyme (ACE) I/D Polymorphism (rs4340)

Univariable analysis showed a trend toward a statistically significant association of genotype with Hunt and Hess grade (p = 0.0682) (Table 2) and mRS score at last follow-up (p = 0.129) (Table 3). The ACE concentration was the lowest in aSAH patients with II genotype (17.6 ± 8.0 U/L) (p = 0.0195) (Table 2).

In logistic regression, there was a recessive effect of the I allele (II vs ID + DD) on Hunt and Hess grade (OR 2.76, 95% CI 1.17–6.50; p = 0.0206) that remained significant after FDR correction. After controlling for Hunt and Hess grade, the effect on mRS was no longer present (OR 1.54, 95% CI 0.498–4.74, p = 0.455). In patients 55 years or younger, there was a similar effect of the I allele on clinical vasospasm and DCI (OR 3.63, 95% CI 1.04–12.7; p = 0.0439); this remained significant after FDR correction (Table 4).

Angiotensin 2 Type 1 Receptor (AT1) A/C Polymorphism (rs5186)

No genotype associations with patient characteristics and outcome measures were identified in univariable analysis for the entire patient group and those older than 55 years. In patients 55 years or younger, genotype was associated with mRS score at last follow-up (p = 0.0374) (Table 3). This association was not statistically significant following FDR correction or logistic regression.

AT2 A/C Polymorphism (rs11091046)

No genotype associations with aSAH were identified in univariable analysis for the entire patient group and patients 55 years or younger (Table 5). In patients older than 55 years, genotype was associated with clinical vasospasm (p = 0.0277) and DCI (p = 0.0332), but this was not significant after FDR correction (Table 6).

TABLE 5.

Patient demographics and characteristics by AT 2 A/C (rs11091046) and AT 2 G/A (rs1403543) genotype*

VariableAT2 A/C (rs11091046)AT2 G/A (rs1403543)
XAXA (n = 23)XAXC (n = 59)XCXC (n = 32)XAY (n = 19)XCY (n = 16)p ValueXAXA (n = 21)XAXG (n = 52)XGXG (n = 41)XAY (n = 20)XGY (n = 15)p Value
HWEp = 0.280 (males), 0.261 (females)p = 0.364 (males), 0.473 (females)
Mean age in yrs53.9 ± 13.755.8 ± 13.156.0 ± 11.550.1 ± 12.456.1 ± 10.30.45657.6 ± 14.255.0 ± 12.255.0 ± 12.753.6 ± 13.351.9 ± 9.50.722
Race0.2590.172
  White11 (47.8)33 (55.9)18 (56.3)15 (78.9)8 (50.0)14 (66.6)30 (57.7)18 (43.9)13 (65.0)10 (66.7)
  African American12 (52.2)25 (42.4)13 (40.6)3 (15.8)7 (43.8)6 (28.6)21 (40.4)23 (56.1)6 (30.0)4 (26.7)
  Other0 (0.0)1 (1.7)1 (3.1)1 (5.3)1 (6.3)1 (4.8)1 (1.9)0 (0.0)1 (5.0)1 (6.7)
Sex<0.0001<0.0001
  Male0 (0.0)0 (0.0)0 (0.0)19 (100)16 (100)0 (0.0)0 (0.0)0 (0.0)20 (100.0)15 (100.0)
  Female23 (100)59 (100)32 (100)0 (0)0 (0)21 (100.0)52 (100.0)41 (100.0)0 (0.0)0 (0.0)
Ischemic vascular disease1 (4.3)3 (5.1)3 (9.4)3 (15.8)3 (18.8)0.2731 (4.8)2 (3.8)4 (9.8)3 (15.0)3 (20.0)0.188
Hypertension13 (56.5)35 (59.3)22 (68.8)9 (47.4)11 (68.8)0.58215 (71.4)29 (55.8)26 (63.4)14 (70.0)6 (40.0)0.298
Smoker0.3740.162
  Never8 (34.8)22 (37.3)17 (53.1)8 (42.1)3 (18.8)9 (42.9)21 (40.4)17 (41.4)7 (35.0)4 (26.7)
  Former3 (13.0)5 (8.5)3 (9.4)4 (21.1)3 (18.8)4 (19.0)3 (5.8)4 (9.8)6 (30.0)1 (6.7)
  Current12 (52.2)32 (54.2)12 (37.5)7 (36.8)10 (62.5)8 (38.1)28 (53.8)20 (48.8)7 (35.0)10 (66.7)
Family history0 (0.0)6 (10.2)5 (15.6)1 (5.3)2 (12.5)0.3054 (19.0)3 (5.8)4 (9.8)2 (10.0)1 (6.7)0.512
Aneurysm size0.5230.202
  <7 mm15 (65.2)35 (59.3)18 (56.3)12 (63.2)13 (81.3)10 (47.6)33 (63.5)25 (61.0)16 (80.0)9 (60.0)
  7–12 mm7 (30.4)23 (39.0)11 (34.4)6 (31.6)2 (12.5)11 (52.4)17 (32.7)13 (31.7)2 (10.0)6 (40.0)
  13–24 mm1 (4.3)1 (1.7)2 (6.3)1 (5.3)1 (6.3)0 (0.0)2 (3.8)2 (4.9)2 (10.0)0 (0.0)
  ≥25 mm0 (0.0)0 (0.0)1 (3.1)0 (0.0)0 (0.0)0 (0.0)0 (0.0)1 (2.4)0 (0.0)0 (0.0)
Location0.4320.295
  Anterior19 (82.6)43 (72.9)28 (87.5)17 (89.5)13 (81.3)18 (85.7)37 (71.2)35 (85.4)16 (80.0)14 (93.3)
  Posterior4 (17.4)16 (27.1)4 (12.5)2 (10.5)3 (18.8)3 (14.3)15 (28.8)6 (14.6)4 (20.0)1 (6.7)
Hunt & Hess grade0.8320.775
  I–III18 (78.3)48 (81.4)23 (71.9)14 (73.7)12 (75.0)15 (71.4)43 (82.7)31 (75.6)15 (75.0)11 (73.3)
  IV & V5 (21.7)11 (18.6)9 (28.1)5 (26.3)4 (25.0)6 (28.6)9 (17.3)10 (24.4)5 (25.0)4 (26.7)
Fisher grade0.9840.410
  1 & 24 (17.4)10 (16.9)4 (12.5)3 (15.8)2 (12.5)6 (28.6)6 (11.5)6 (14.6)2 (10.0)3 (20.0)
  3 & 419 (82.6)49 (83.1)28 (87.5)16 (84.2)14 (87.5)15 (71.4)46 (88.5)35 (85.4)18 (90.0)12 (80.0)
Treatment§0.9990.730
  Clipping11 (52.4)30 (50.8)16 (53.3)10 (52.6)9 (56.3)8 (38.1)29 (55.8)20 (54.1)11 (55.0)8 (53.3)
  Endovascular10 (47.6)29 (49.2)14 (46.7)9 (47.4)7 (43.8)13 (61.9)23 (44.2)17 (45.9)9 (45.0)7 (46.7)
Rerupture2 (8.7)1 (1.7)2 (6.3)1 (5.3)1 (6.3)0.4232 (9.5)1 (1.9)2 (4.9)2 (10.0)0 (0.0)0.321

Values indicate number of patients (%) unless specified otherwise. Mean values are presented as the mean ± SD.

Genotype was not available for 2 patients.

Significant after FDR correction.

Data were not available for 4 aneurysms.

TABLE 6.

Outcome measures by AT2 A/C (rs11091046) and AT2 G/A (rs1403543) genotype for all patients, patients older than 55 years, and patients 55 years or younger*

Age Group & VariableAT2 A/C (rs11091046)AT2 G/A (rs1403543)
XAXAXAXCXCXCXAYXCYp ValueXAXAXAXGXGXGXAYXGYp Value
All patients
  No. of patients23593219162152412015
  Clinical vasospasm8 (34.8)10 (16.9)10 (31.3)5 (26.3)1 (6.3)0.1305 (23.8)10 (19.2)13 (31.7)3 (15.0)3 (20.0)0.603
  DCI7 (31.8)9 (15.3)9 (30.0)5 (26.3)1 (6.3)0.1505 (23.8)10 (19.2)10 (26.3)3 (15.0)3 (20.0)0.881
  Mean ICU stay in days13.1 ± 9.511.8 ± 7.715.0 ± 7.011.8 ± 7.212.3 ± 10.90.91312.0 ± 6.911.9 ± 7.511.2 ± 8.011.9 ± 8.512.2 ± 9.80.954
  Mean hospital stay in days19.3 ± 19.215.0 ± 9.111.0 ± 5.416.1 ± 10.115.4 ± 12.20.62816.7 ± 7.515.0 ± 8.916.6 ± 15.516.1 ± 10.715.4 ± 11.50.957
  Discharge mRS score0.7920.729
    0–316 (69.6)36 (61.0)21 (65.6)10 (52.6)9 (56.3)15 (71.4)33 (63.5)25 (61.0)10 (50.0)9 (60.0)
    4–67 (30.4)23 (39.0)11 (34.4)9 (47.4)7 (43.8)6 (28.6)19 (36.5)16 (39.0)10 (50.0)6 (40.0)
  mRS score at last follow-up0.7530.619
    0–317 (73.9)50 (84.7)26 (81.3)15 (78.9)12 (75.0)17 (81.0)45 (86.5)31 (75.6)16 (80.0)11 (73.3)
    4–66 (26.1)9 (15.3)6 (18.8)4 (21.1)4 (25.0)4 (19.0)7 (13.5)10 (24.4)4 (20.0)4 (26.7)
  Mean length of follow-up in days224 ± 171273 ± 184286 ± 188155 ± 171239 ± 2180.109252 ± 151282 ± 196256 ± 183184 ± 164206 ± 2360.307
≤ 55 yrs
  No. of patients11291312892717911
  Clinical vasospasm2 (18.2)6 (20.7)3 (23.1)3 (25.0)1 (12.5)0.9910 (0.0)5 (18.5)6 (35.3)1 (11.1)3 (27.3)0.265
  DCI1 (9.1)5 (17.2)5 (38.5)3 (25.0)1 (12.5)0.1501 (11.1)6 (22.2)4 (23.5)1 (11.1)3 (27.3)0.905
  Mean ICU stay in days10.5 ± 4.210.5 ± 5.89.2 ± 3.111.5 ± 4.513.4 ± 12.70.6339.4 ± 3.010.4 ± 5.810.2 ± 4.210.2 ± 4.813.9 ± 10.60.461
Mean hospital stay in days13.6 ± 4.313.3 ± 6.913.3 ± 6.416.4 ± 9.715.8 ± 12.40.75012.6 ± 3.013.2 ± 6.914.0 ± 6.715.0 ± 7.717.1 ± 12.70.653
  Discharge mRS score0.5620.313
    0–39 (81.8)19 (65.5)11 (84.6)7 (58.3)6 (75.0)9 (100.0)18 (66.7)12 (70.6)6 (66.7)7 (63.6)
    4–62 (18.2)10 (34.5)2 (15.4)5 (41.7)2 (25.0)0 (0.0)9 (33.3)5 (29.4)3 (33.3)4 (36.4)
  mRS score at last follow-up0.7530.214
    0–39 (81.8)27 (93.1)12 (92.3)10 (83.3)7 (87.5)9 (100.0)25 (92.6)14 (82.4)9 (100.0)8 (72.7)
    4–62 (18.2)2 (6.9)1 (7.7)2 (16.7)1 (12.5)0 (0.0)2 (7.4)3 (17.6)0 (0.0)3 (27.3)
  Mean length of follow-up in days240 ± 201258 ± 175314 ± 21999 ± 131327 ± 2440.0414256 ± 153280 ± 211256 ± 181152 ± 161221 ± 2500.562
>55 yrs
  No. of patients12301978122524114
  Clinical vasospasm6 (50.0)4 (13.3)7 (36.8)2 (28.6)0 (0.0)0.02775 (41.7)5 (20.0)7 (29.2)2 (18.2)0 (0.0)0.492
  DCI6 (54.5)4 (13.3)4 (23.5)2 (28.6)0 (0.0)0.03324 (33.3)4 (16.0)6 (28.6)2 (18.2)0 (0.0)0.608
  Mean ICU stay in days15.5 ± 12.312.9 ± 9.212.3 ± 6.312.4 ± 10.811.1 ± 9.60.85615.5 ± 8.016.8 ± 10.511.9 ± 9.913.3 ± 10.77.5 ± 6.00.617
  Mean hospital stay in days24.4 ± 25.716.7 ± 10.716.2 ± 7.315.6 ± 11.515.1 ± 12.80.45819.8 ± 8.413.4 ± 8.818.5 ± 19.417.0 ± 13.010.8 ± 6.90.835
  Discharge mRS score0.9000.790
    0–37 (58.3)17 (56.7)10 (52.6)3 (42.9)3 (37.5)6 (50.0)15 (60.0)13 (54.2)4 (36.4)2 (50.0)
    4–65 (41.7)13 (43.3)9 (47.4)4 (57.1)5 (62.5)6 (50.0)10 (40.0)11 (45.8)7 (63.6)2 (50.0)
  mRS score at last follow-up0.9000.833
    0–38 (66.7)23 (76.7)14 (73.7)5 (71.4)5 (62.5)8 (66.7)20 (80.0)17 (70.8)7 (63.6)3 (75.0)
    4–64 (33.3)7 (23.3)5 (26.3)2 (28.6)3 (37.5)4 (33.3)5 (20.0)7 (29.2)4 (36.4)1 (25.0)
Mean length of follow-up in days209 ± 146288 ± 195268 ± 168251 ± 198150 ± 1550.328249 ± 156284 ± 183257 ± 188209 ± 170165 ± 2230.677

Values represent number of patients (%) unless noted otherwise. Mean values are presented as the mean ± SD.

Genotype was not available for 2 patients.

Data were not available for 3 aneurysms.

In logistic regression, there was a recessive effect of allele A (XAXA + XAY vs XAXC + XCXC + XCY) on clinical vasospasm (OR 3.04, 95% CI 0.990–9.30; p = 0.0523) and DCI (OR 4.70, 95% CI 1.43–15.4; p = 0.0111); these findings remained significant after FDR correction (Table 4).

AT2 G/A Polymorphism (rs1403543)

No genotype associations with aSAH were identified in univariable analysis for the entire patient group and subgroups of patients ≤ 55 years or younger and those older than 55 years (Tables 5 and 6).

Discussion

The CARAS10,11 study prospectively enrolled aSAH patients and controls to evaluate associations among common RAS genetic polymorphisms and identified a dominant effect of allele C of AT2 A/C SNP on aSAH in patients older than 55 years (Griessenauer et al., unpublished data, 2016). Whereas systemic RAS is a potent vasoregulator, local RAS plays a significant role in vascular remodeling. Selective association of this receptor polymorphism with aSAH suggests that antitrophic effects mediated through AT2 receptors on vascular smooth muscle cells (VSMCs) may be relevant to the formation and rupture of cerebral aneurysms. In the present study, there were significant associations of RAS polymorphisms with the clinical course of aSAH. The I allele of the ACE I/D polymorphism was associated with poor Hunt and Hess grade and subsequent poor functional outcome. Both the I allele of the ACE I/D polymorphism and the A allele of the AT2 A/C SNP demonstrated age-dependent associations with clinical vasospasm and DCI.

Renin-Angiotensin Polymorphisms and Risk Factors for aSAH

This study identified important associations for the AGT C/T and ACE I/D polymorphism and risk factors for aSAH. Patients homozygous for the C allele of the AGT C/T polymorphism experienced a higher rate of rupture from aneurysms smaller than 7 mm. Identification of risk factors for rupture of small aneurysms is critically important, as size remains a controversial issue in aneurysm management. While the average size of ruptured aneurysms measures 6 to 7 mm,15,21 natural history studies of unruptured aneurysms indicate a benign course for small aneurysms. The ISUIA (International Study of Unruptured Intracranial Aneurysms) reported a 5-year cumulative rupture rate of 1.5% and 0% for aneurysms smaller than 7 mm in the anterior circulation in patients with and without a history of SAH, respectively.31 The UCAS (Natural Course of Unruptured Cerebral Aneurysm Study of Japan) found annual rupture rates of 0.36% and 0.5% for aneurysms measuring 3–4 mm and 5–6 mm, respectively.22 Both studies, however, were likely influenced by treatment selection bias. In UCAS, 69.7% of all aneurysms selected for elective treatment were smaller than 7 mm in maximum diameter. Factors currently considered in the decision to electively treat small aneurysms include female sex, young age, smoking, hypertension, history of aSAH, and aneurysm morphology.5,19 Whereas a family history of aSAH is a recognized risk factor, specific genetic information is not currently part of routine aneurysm management. Associations between genetic risk factors and aneurysm size at the time of rupture have been investigated. Of the 7 SNPs found to be associated with aneurysms in genome-wide association studies, none exerted influence on the aneurysm size at rupture.18 These genetic risk loci, however, only explain approximately 5% of the genetic risk for aneurysms18 and did not include the AGT C/T polymorphism. The AGT TT genotype is associated with hypertension in women and increased plasma AGT levels.25,27 The CC genotype may result in decreased AGT levels and subsequently decreased local RAS activity. Reduced vascular remodeling due to locally downregulated RAS may lead to thinning and weakening of the arterial wall and aneurysm rupture at a smaller size. Another SNP linked to aneurysm size at rupture is the endothelial nitric oxide synthase (eNOS) T786C SNP. Patients homozygous for either T or C alleles experienced rupture of smaller aneurysms compared with heterozygotes.17 Interestingly, neither AGT C/T (Griessenauer et al., unpublished data, 2016) nor eNOS was associated with aSAH as compared with controls.17

The present study also found recessive effects of the I allele of the ACE I/D polymorphism on Hunt and Hess grade and subsequent functional outcome. Whereas the II genotype was found to be associated with aSAH,16,24,27 no such effect was found in CARAS.24 The II genotype is associated with the lowest ACE activity; thus, bradykinin levels are predicted to be increased, resulting in more vascular dilation and less VSMC proliferation locally.32 While aneurysm formation and rupture may be associated with decreased local RAS activity, decreased systemic RAS activity linked to the I allele may be responsible for the association with poor Hunt and Hess grade. In the acute setting of the aneurysm rupture there is a sudden surge in intracranial pressure and deterioration of cerebral autoregulation.4 Thus, systemic vasoregulation is critical for maintaining cerebral perfusion. Decreased systemic RAS activity associated with the I allele may complicate maintenance of cerebral perfusion and render the patient more susceptible to transient ischemia. This process may be exacerbated if the patient also suffers from hydrocephalus. The ACE I/D genotype was not independently associated with functional outcome, and poor functional outcome associated with the II genotype may be an effect of poor Hunt and Hess grade.

Clinical Vasospasm and DCI

Once the aneurysm is secured, DCI represents the most significant threat to a patient's clinical course. The current study identified important associations among RAS polymorphisms, clinical vasospasm, and DCI. While there were recessive effects of the I allele of the ACE I/D polymorphism in patients 55 years and younger, DCI in older patients was associated with the A allele of the AT2 A/C SNP. Both systemic and local RAS modulation may be involved in the development of DCI. Younger patients homozygous for the I allele may have difficulties mounting a systemic response to cerebral vasospasm, making them susceptible to DCI. The C allele of the AT2 SNP has been associated with trophic effects in the local RAS.8 While antitrophic effects on the VSMCs appear to predispose to aneurysm formation and rupture, overactivation of the VSMCs via the local AT2 receptor may exacerbate vasospasm and DCI. Activation of RAS in aSAH occurs around 4 to 6 days after aneurysm rupture as a response to sodium and water loss triggered by brain and atrial natriuretic peptides.20 This delayed RAS activation coincides with the onset of cerebral vasospasm, and it is plausible that in an interrelated system of enzymes and substrates such as RAS, a change in activity or level of individual components may alter the susceptibility for clinical vasospasm and DCI. Other genetic polymorphisms associated with vasospasm and DCI include endothelin-1,12 cystathionine b-synthase,13 eNOS,26,29 haptoglobin,26 and plasminogen activator inhibitor-1.30 How these polymorphisms relate to the RAS-related effects identified in the present study remains to be determined.

Limitations and Future Directions

There are limitations to the present study. Patients who died prior to or soon after admission could not be consented to participate in the study. Thus, findings only apply to aSAH patients who survived the acute phase. Methodologically, multiple testing may find false-positive associations of genotypes with outcome measures by chance. In an effort to reduce the rate of false-positive findings, we performed adjustment of the FDR associated with multiple comparisons.1 The population and sample size was relatively small, a recognized limitation of studying rare disease processes. The patient population represented individuals presenting to a tertiary referral center in the eastern and southeastern United States, thus limiting broad generalizability. Lastly, the associations identified in the present study occurred on the genomic level. Future work will focus on gene expression profiles and protein activity associated with the polymorphism investigated to delineate the precise mechanism by which RAS polymorphisms may affect the clinical course after aSAH.

Conclusions

The RAS appears to play a role in the clinical course of aSAH patients. Both the ACE I/D polymorphism and the AT2 A/C SNP were associated an age-dependent risk of DCI, whereas only the ACE I/D polymorphism was associated with poor clinical grade at presentation. Further studies are required to elucidate the relevant pathophysiology and its potential implication in treatment of patients with aSAH.

Acknowledgments

This study received the support of the Brain Aneurysm Foundation.

References

  • 1

    Benjamini Y, Hochberg Y: Controlling the false discovery rate: a practical and powerful approach to multiple testing. J R Stat Soc Series B Stat Methodol 57:289300, 1995

    • Search Google Scholar
    • Export Citation
  • 2

    Brooks DP, Ruffolo RR, Functions mediated by peripheral angiotensin II receptors. Ruffolo RR: Angiotensin II Receptors, Vol 1: Molecular Biology, Biochemistry, Pharmacology and Clinical Perspectives Boca Raton, FL, CRC Press, 1994. 71102

    • Search Google Scholar
    • Export Citation
  • 3

    Bruno A, Akinwuntan AE, Lin C, Close B, Davis K, Baute V, et al.: Simplified modified Rankin scale questionnaire: reproducibility over the telephone and validation with quality of life. Stroke 42:22762279, 2011

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 4

    Calviere L, Nasr N, Arnaud C, Czosnyka M, Viguier A, Tissot B, et al.: Prediction of delayed cerebral ischemia after subarachnoid hemorrhage using cerebral blood flow velocities and cerebral autoregulation assessment. Neurocrit Care 23:253258, 2015

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 5

    Chalouhi N, Zanaty M, Whiting A, Yang S, Tjoumakaris S, Hasan D, et al.: Safety and efficacy of the Pipeline Embolization Device in 100 small intracranial aneurysms. J Neurosurg 122:14981502, 2015

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 6

    Connolly ES Jr, Rabinstein AA, Carhuapoma JR, Derdeyn CP, Dion J, Higashida RT, et al.: Guidelines for the management of aneurysmal subarachnoid hemorrhage: a guideline for healthcare professionals from the American Heart Association/American Stroke Association. Stroke 43:17111737, 2012

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 7

    Dankbaar JW, Slooter AJ, Rinkel GJ, Schaaf IC: Effect of different components of triple-H therapy on cerebral perfusion in patients with aneurysmal subarachnoid haemorrhage: a systematic review. Crit Care 14:R23, 2010

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 8

    Deinum J, van Gool JM, Kofflard MJ, ten Cate FJ, Danser AH: Angiotensin II type 2 receptors and cardiac hypertrophy in women with hypertrophic cardiomyopathy. Hypertension 38:12781281, 2001

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 9

    Drenjancevic-Peric I, Phillips SA, Falck JR, Lombard JH: Restoration of normal vascular relaxation mechanisms in cerebral arteries by chromosomal substitution in consomic SS.13BN rats. Am J Physiol Heart Circ Physiol 289:H188H195, 2005

    • Search Google Scholar
    • Export Citation
  • 10

    Foreman PM, Chua M, Harrigan MR, Fisher WS III, Tubbs RS, Shoja MM, et al.: Antifibrinolytic therapy in aneurysmal subarachnoid hemorrhage increases the risk for deep venous thrombosis: A case-control study. Clin Neurol Neurosurg 139:6669, 2015

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 11

    Foreman PM, Chua MH, Harrigan MR, Fisher WS III, Vyas NA, Lipsky RH, et al.: Association of nosocomial infections with delayed cerebral ischemia in aneurysmal subarachnoid hemorrhage. J Neurosurg [epub ahead of print February 12, 2016. DOI: 10.3171/2015.10.JNS151959]

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 12

    Gallek M, Alexander S, Crago E, Sherwood P, Horowitz M, Poloyac S, et al.: Endothelin-1 and endothelin receptor gene variants and their association with negative outcomes following aneurysmal subarachnoid hemorrhage. Biol Res Nurs 15:390397, 2013

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 13

    Grobelny BT, Ducruet AF, DeRosa PA, Kotchetkov IS, Zacharia BE, Hickman ZL, et al.: Gain-of-function polymorphisms of cystathionine β-synthase and delayed cerebral ischemia following aneurysmal subarachnoid hemorrhage. J Neurosurg 115:101107, 2011

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 14

    Haberl RL, Decker-Hermann PJ, Hermann K: Effect of renin on brain arterioles and cerebral blood flow in rabbits. J Cereb Blood Flow Metab 16:714719, 1996

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 15

    Harrigan M, Deveikis J: Intracranial aneurysms and subarachnoid hemorrhage. Handbook of Cerebrovascular Disease and Neurointerventional Technique New York, Humana Press, 2009. 443

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 16

    Keramatipour M, McConnell RS, Kirkpatrick P, Tebbs S, Furlong RA, Rubinsztein DC: The ACE I allele is associated with increased risk for ruptured intracranial aneurysms. J Med Genet 37:498500, 2000

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 17

    Khurana VG, Sohni YR, Mangrum WI, McClelland RL, O'Kane DJ, Meyer FB, et al.: Endothelial nitric oxide synthase T-786C single nucleotide polymorphism: a putative genetic marker differentiating small versus large ruptured intracranial aneurysms. Stroke 34:25552559, 2003

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 18

    Kleinloog R, van 't Hof FNG, Wolters FJ, Rasing I, van der Schaaf IC, Rinkel GJE, et al.: The association between genetic risk factors and the size of intracranial aneurysms at time of rupture. Neurosurgery 73:705708, 2013

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 19

    Korja M, Lehto H, Juvela S: Lifelong rupture risk of intracranial aneurysms depends on risk factors: a prospective Finnish cohort study. Stroke 45:19581963, 2014

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 20

    Lo BWY, Fukuda H, Nishimura Y, Macdonald RL, Farrokhyar F, Thabane L, et al.: Pathophysiologic mechanisms of brain-body associations in ruptured brain aneurysms: A systematic review. Surg Neurol Int 6:136, 2015

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 21

    McDougall CG, Spetzler RF, Zabramski JM, Partovi S, Hills NK, Nakaji P, et al.: The Barrow Ruptured Aneurysm Trial. J Neurosurg 116:135144, 2012

  • 22

    Morita A, Kirino T, Hashi K, Aoki N, Fukuhara S, Hashimoto N, et al.: The natural course of unruptured cerebral aneurysms in a Japanese cohort. N Engl J Med 366:24742482, 2012

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 23

    Ohkuma H, Suzuki S, Fujita S, Nakamura W: Role of a decreased expression of the local renin-angiotensin system in the etiology of cerebral aneurysms. Circulation 108:785787, 2003

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 24

    Peck G, Smeeth L, Whittaker J, Casas JP, Hingorani A, Sharma P: The genetics of primary haemorrhagic stroke, subarachnoid haemorrhage and ruptured intracranial aneurysms in adults. PLoS One 3:e3691, 2008

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 25

    Petkeviciene J, Klumbiene J, Simonyte S, Ceponiene I, Jureniene K, Kriaucioniene V, et al.: Physical, behavioural and genetic predictors of adult hypertension: the findings of the Kaunas Cardiovascular Risk Cohort study. PLoS One 9:e109974, 2014

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 26

    Rosalind Lai PM, Du R: Role of genetic polymorphisms in predicting delayed cerebral ischemia and radiographic vasospasm after aneurysmal subarachnoid hemorrhage: a meta-analysis. World Neurosurg 84:933941, 941.e1941.e2, 2015

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 27

    Sethi AA, Nordestgaard BG, Agerholm-Larsen B, Frandsen E, Jensen G, Tybjaerg-Hansen A: Angiotensinogen polymorphisms and elevated blood pressure in the general population: the Copenhagen City Heart Study. Hypertension 37:875881, 2001

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 28

    Slowik A, Borratynska A, Pera J, Betlej M, Dziedzic T, Krzyszkowski T, et al.: II genotype of the angiotensin-converting enzyme gene increases the risk for subarachnoid hemorrhage from ruptured aneurysm. Stroke 35:15941597, 2004

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 29

    Starke RM, Kim GH, Komotar RJ, Hickman ZL, Black EM, Rosales MB, et al.: Endothelial nitric oxide synthase gene single-nucleotide polymorphism predicts cerebral vasospasm after aneurysmal subarachnoid hemorrhage. J Cereb Blood Flow Metab 28:12041211, 2008

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 30

    Vergouwen MDI, Frijns CJM, Roos YBWEM, Rinkel GJE, Baas F, Vermeulen M: Plasminogen activator inhibitor-1 4G allele in the 4G/5G promoter polymorphism increases the occurrence of cerebral ischemia after aneurysmal subarachnoid hemorrhage. Stroke 35:12801283, 2004

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 31

    Wiebers DO, Whisnant JP, Huston J III, Meissner I, Brown RD Jr, Piepgras DG, et al.: Unruptured intracranial aneurysms: natural history, clinical outcome, and risks of surgical and endovascular treatment. Lancet 362:103110, 2003

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 32

    Yayama K, Okamoto H: Angiotensin II-induced vasodilation via type 2 receptor: role of bradykinin and nitric oxide. Int Immunopharmacol 8:312318, 2008

Disclosures

The authors report no conflict of interest concerning the materials or methods used in this study or the findings specified in this paper.

Author Contributions

Conception and design: Griessenauer, Tubbs, Shoja. Acquisition of data: Griessenauer, Foreman, Vyas. Analysis and interpretation of data: Griessenauer, Foreman, Chua, Vyas, Lipsky, Lin, Iyer, Haridas, Chaudry, Malieva, Wilkins, Shoja. Drafting the article: Griessenauer, Foreman. Critically revising the article: Griessenauer, Tubbs, Foreman, Chua, Lipsky, Lin, Shoja. Reviewed submitted version of manuscript: Griessenauer, Tubbs, Foreman, Shoja. Approved the final version of the manuscript on behalf of all authors: Griessenauer. Statistical analysis: Griessenauer, Chua. Administrative/technical/material support: Griessenauer, Tubbs, Vyas, Lipsky, Lin, Iyer, Haridas, Walters, Harrigan, Fisher, Shoja. Study supervision: Griessenauer, Walters, Harrigan, Fisher, Shoja.

  • 1

    Benjamini Y, Hochberg Y: Controlling the false discovery rate: a practical and powerful approach to multiple testing. J R Stat Soc Series B Stat Methodol 57:289300, 1995

    • Search Google Scholar
    • Export Citation
  • 2

    Brooks DP, Ruffolo RR, Functions mediated by peripheral angiotensin II receptors. Ruffolo RR: Angiotensin II Receptors, Vol 1: Molecular Biology, Biochemistry, Pharmacology and Clinical Perspectives Boca Raton, FL, CRC Press, 1994. 71102

    • Search Google Scholar
    • Export Citation
  • 3

    Bruno A, Akinwuntan AE, Lin C, Close B, Davis K, Baute V, et al.: Simplified modified Rankin scale questionnaire: reproducibility over the telephone and validation with quality of life. Stroke 42:22762279, 2011

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 4

    Calviere L, Nasr N, Arnaud C, Czosnyka M, Viguier A, Tissot B, et al.: Prediction of delayed cerebral ischemia after subarachnoid hemorrhage using cerebral blood flow velocities and cerebral autoregulation assessment. Neurocrit Care 23:253258, 2015

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 5

    Chalouhi N, Zanaty M, Whiting A, Yang S, Tjoumakaris S, Hasan D, et al.: Safety and efficacy of the Pipeline Embolization Device in 100 small intracranial aneurysms. J Neurosurg 122:14981502, 2015

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 6

    Connolly ES Jr, Rabinstein AA, Carhuapoma JR, Derdeyn CP, Dion J, Higashida RT, et al.: Guidelines for the management of aneurysmal subarachnoid hemorrhage: a guideline for healthcare professionals from the American Heart Association/American Stroke Association. Stroke 43:17111737, 2012

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 7

    Dankbaar JW, Slooter AJ, Rinkel GJ, Schaaf IC: Effect of different components of triple-H therapy on cerebral perfusion in patients with aneurysmal subarachnoid haemorrhage: a systematic review. Crit Care 14:R23, 2010

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 8

    Deinum J, van Gool JM, Kofflard MJ, ten Cate FJ, Danser AH: Angiotensin II type 2 receptors and cardiac hypertrophy in women with hypertrophic cardiomyopathy. Hypertension 38:12781281, 2001

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 9

    Drenjancevic-Peric I, Phillips SA, Falck JR, Lombard JH: Restoration of normal vascular relaxation mechanisms in cerebral arteries by chromosomal substitution in consomic SS.13BN rats. Am J Physiol Heart Circ Physiol 289:H188H195, 2005

    • Search Google Scholar
    • Export Citation
  • 10

    Foreman PM, Chua M, Harrigan MR, Fisher WS III, Tubbs RS, Shoja MM, et al.: Antifibrinolytic therapy in aneurysmal subarachnoid hemorrhage increases the risk for deep venous thrombosis: A case-control study. Clin Neurol Neurosurg 139:6669, 2015

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 11

    Foreman PM, Chua MH, Harrigan MR, Fisher WS III, Vyas NA, Lipsky RH, et al.: Association of nosocomial infections with delayed cerebral ischemia in aneurysmal subarachnoid hemorrhage. J Neurosurg [epub ahead of print February 12, 2016. DOI: 10.3171/2015.10.JNS151959]

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 12

    Gallek M, Alexander S, Crago E, Sherwood P, Horowitz M, Poloyac S, et al.: Endothelin-1 and endothelin receptor gene variants and their association with negative outcomes following aneurysmal subarachnoid hemorrhage. Biol Res Nurs 15:390397, 2013

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 13

    Grobelny BT, Ducruet AF, DeRosa PA, Kotchetkov IS, Zacharia BE, Hickman ZL, et al.: Gain-of-function polymorphisms of cystathionine β-synthase and delayed cerebral ischemia following aneurysmal subarachnoid hemorrhage. J Neurosurg 115:101107, 2011

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 14

    Haberl RL, Decker-Hermann PJ, Hermann K: Effect of renin on brain arterioles and cerebral blood flow in rabbits. J Cereb Blood Flow Metab 16:714719, 1996

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 15

    Harrigan M, Deveikis J: Intracranial aneurysms and subarachnoid hemorrhage. Handbook of Cerebrovascular Disease and Neurointerventional Technique New York, Humana Press, 2009. 443

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 16

    Keramatipour M, McConnell RS, Kirkpatrick P, Tebbs S, Furlong RA, Rubinsztein DC: The ACE I allele is associated with increased risk for ruptured intracranial aneurysms. J Med Genet 37:498500, 2000

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 17

    Khurana VG, Sohni YR, Mangrum WI, McClelland RL, O'Kane DJ, Meyer FB, et al.: Endothelial nitric oxide synthase T-786C single nucleotide polymorphism: a putative genetic marker differentiating small versus large ruptured intracranial aneurysms. Stroke 34:25552559, 2003

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 18

    Kleinloog R, van 't Hof FNG, Wolters FJ, Rasing I, van der Schaaf IC, Rinkel GJE, et al.: The association between genetic risk factors and the size of intracranial aneurysms at time of rupture. Neurosurgery 73:705708, 2013

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 19

    Korja M, Lehto H, Juvela S: Lifelong rupture risk of intracranial aneurysms depends on risk factors: a prospective Finnish cohort study. Stroke 45:19581963, 2014

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 20

    Lo BWY, Fukuda H, Nishimura Y, Macdonald RL, Farrokhyar F, Thabane L, et al.: Pathophysiologic mechanisms of brain-body associations in ruptured brain aneurysms: A systematic review. Surg Neurol Int 6:136, 2015

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 21

    McDougall CG, Spetzler RF, Zabramski JM, Partovi S, Hills NK, Nakaji P, et al.: The Barrow Ruptured Aneurysm Trial. J Neurosurg 116:135144, 2012

  • 22

    Morita A, Kirino T, Hashi K, Aoki N, Fukuhara S, Hashimoto N, et al.: The natural course of unruptured cerebral aneurysms in a Japanese cohort. N Engl J Med 366:24742482, 2012

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 23

    Ohkuma H, Suzuki S, Fujita S, Nakamura W: Role of a decreased expression of the local renin-angiotensin system in the etiology of cerebral aneurysms. Circulation 108:785787, 2003

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 24

    Peck G, Smeeth L, Whittaker J, Casas JP, Hingorani A, Sharma P: The genetics of primary haemorrhagic stroke, subarachnoid haemorrhage and ruptured intracranial aneurysms in adults. PLoS One 3:e3691, 2008

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 25

    Petkeviciene J, Klumbiene J, Simonyte S, Ceponiene I, Jureniene K, Kriaucioniene V, et al.: Physical, behavioural and genetic predictors of adult hypertension: the findings of the Kaunas Cardiovascular Risk Cohort study. PLoS One 9:e109974, 2014

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 26

    Rosalind Lai PM, Du R: Role of genetic polymorphisms in predicting delayed cerebral ischemia and radiographic vasospasm after aneurysmal subarachnoid hemorrhage: a meta-analysis. World Neurosurg 84:933941, 941.e1941.e2, 2015

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 27

    Sethi AA, Nordestgaard BG, Agerholm-Larsen B, Frandsen E, Jensen G, Tybjaerg-Hansen A: Angiotensinogen polymorphisms and elevated blood pressure in the general population: the Copenhagen City Heart Study. Hypertension 37:875881, 2001

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 28

    Slowik A, Borratynska A, Pera J, Betlej M, Dziedzic T, Krzyszkowski T, et al.: II genotype of the angiotensin-converting enzyme gene increases the risk for subarachnoid hemorrhage from ruptured aneurysm. Stroke 35:15941597, 2004

    • Crossref
    • PubMed
    • Search Google Scholar
    • Export Citation
  • 29

    Starke RM, Kim GH, Komotar RJ, Hickman ZL, Black EM, Rosales MB, et al.: Endothelial nitric oxide synthase gene single-nucleotide polymorphism predicts cerebral vasospasm after aneurysmal subarachnoid hemorrhage. J Cereb Blood Flow Metab 28:12041211,