STAT-1 expression is regulated by IGFBP-3 in malignant glioma cells and is a strong predictor of poor survival in patients with glioblastoma

Laboratory investigation

Full access

Object

Insulin-like growth factor binding proteins (IGFBPs) have been implicated in the pathogenesis of glioma. In a previous study the authors demonstrated that IGFBP-3 is a novel glioblastoma biomarker associated with poor survival. Since signal transducer and activator of transcription 1 (STAT-1) has been shown to be regulated by IGFBP-3 during chondrogenesis and is a prosurvival and radioresistant molecule in different tumors, the aim in the present study was to explore the functional significance of IGFBP-3 in malignant glioma cells, to determine if STAT-1 is indeed regulated by IGFBP-3, and to study the potential of STAT-1 as a biomarker in glioblastoma.

Methods

The functional significance of IGFBP-3 was investigated using the short hairpin (sh)RNA gene knockdown approach on U251MG cells. STAT-1 regulation by IGFBP-3 was tested on U251MG and U87MG cells by shRNA gene knockdown and exogenous treatment with recombinant IGFBP-3 protein. Subsequently, the expression of STAT-1 was analyzed with real-time reverse transcription–polymerase chain reaction (RT-PCR) and immunohistochemistry (IHC) in glioblastoma and control brain tissues. Survival analyses were done on a uniformly treated prospective cohort of adults with newly diagnosed glioblastoma (136 patients) using Kaplan-Meier and Cox regression models.

Results

IGFBP-3 knockdown significantly impaired proliferation, motility, migration, and invasive capacity of U251MG cells in vitro (p < 0.005). Exogenous overexpression of IGFBP-3 in U251MG and U87MG cells demonstrated STAT-1 regulation. The mean transcript levels (by real-time RT-PCR) and the mean labeling index of STAT-1 (by IHC) were significantly higher in glioblastoma than in control brain tissues (p = 0.0239 and p < 0.001, respectively). Multivariate survival analysis revealed that STAT-1 protein expression (HR 1.015, p = 0.033, 95% CI 1.001–1.029) along with patient age (HR 1.025, p = 0.005, 95% CI 1.008–1.042) were significant predictors of shorter survival in patients with glioblastoma.

Conclusions

IGFBP-3 influences tumor cell proliferation, migration, and invasion and regulates STAT-1 expression in malignant glioma cells. STAT-1 is overexpressed in human glioblastoma tissues and emerges as a novel prognostic biomarker.

Abbreviations used in this paper:DMEM = Dulbecco's modified Eagle's medium; FBS = fetal bovine serum; GBM = glioblastoma; HRP = horseradish peroxidase; IFN = interferon; IGF = insulin-like growth factor; IGFBP = IGF binding protein; IHC = immunohistochemistry; IR = insulin receptor; KPS = Karnofsky Performance Scale; LI = labeling index; MTT = 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; OD = optical density; qPCR = quantitative polymerase chain reaction; shRNA = short hairpin RNA; STAT-1 = signal transducer and activator of transcription 1; TGFβ = transforming growth factor–β.

Object

Insulin-like growth factor binding proteins (IGFBPs) have been implicated in the pathogenesis of glioma. In a previous study the authors demonstrated that IGFBP-3 is a novel glioblastoma biomarker associated with poor survival. Since signal transducer and activator of transcription 1 (STAT-1) has been shown to be regulated by IGFBP-3 during chondrogenesis and is a prosurvival and radioresistant molecule in different tumors, the aim in the present study was to explore the functional significance of IGFBP-3 in malignant glioma cells, to determine if STAT-1 is indeed regulated by IGFBP-3, and to study the potential of STAT-1 as a biomarker in glioblastoma.

Methods

The functional significance of IGFBP-3 was investigated using the short hairpin (sh)RNA gene knockdown approach on U251MG cells. STAT-1 regulation by IGFBP-3 was tested on U251MG and U87MG cells by shRNA gene knockdown and exogenous treatment with recombinant IGFBP-3 protein. Subsequently, the expression of STAT-1 was analyzed with real-time reverse transcription–polymerase chain reaction (RT-PCR) and immunohistochemistry (IHC) in glioblastoma and control brain tissues. Survival analyses were done on a uniformly treated prospective cohort of adults with newly diagnosed glioblastoma (136 patients) using Kaplan-Meier and Cox regression models.

Results

IGFBP-3 knockdown significantly impaired proliferation, motility, migration, and invasive capacity of U251MG cells in vitro (p < 0.005). Exogenous overexpression of IGFBP-3 in U251MG and U87MG cells demonstrated STAT-1 regulation. The mean transcript levels (by real-time RT-PCR) and the mean labeling index of STAT-1 (by IHC) were significantly higher in glioblastoma than in control brain tissues (p = 0.0239 and p < 0.001, respectively). Multivariate survival analysis revealed that STAT-1 protein expression (HR 1.015, p = 0.033, 95% CI 1.001–1.029) along with patient age (HR 1.025, p = 0.005, 95% CI 1.008–1.042) were significant predictors of shorter survival in patients with glioblastoma.

Conclusions

IGFBP-3 influences tumor cell proliferation, migration, and invasion and regulates STAT-1 expression in malignant glioma cells. STAT-1 is overexpressed in human glioblastoma tissues and emerges as a novel prognostic biomarker.

The insulin-like growth factor (IGF) signaling pathway has been shown to contribute to glioma progression.54,56 The IGF signaling axis involves two ligands (IGF-1 and IGF-2), three cell surface receptors (insulin receptor [IR], IGF-1 receptor [IGF-1R], and IGF-2R), IGF binding proteins (IGFBPs), and the proteases that affect the binding proteins. The IGFBPs bind and regulate the functions of IGFs44,56 by modulating the bioavailability of IGFs and regulating tumor growth and invasion.55,56 IGFBP-3, with a molecular weight of 43–45 kD, is the most abundant of the IGFBPs in the circulation. It serves as a carrier for the IGFs and also directly modulates the actions of IGF-1 and -2 in tissues.3,45 It is a primary transport protein and thus can both enhance and inhibit IGF-1 actions. Furthermore, it has been shown to exhibit effects on proliferation, migration, and apoptosis that are independent of IGF signaling.7,40 Presumably, these multifunctional roles for IGFBP-3 are influenced by posttranslational modifications and susceptibility to proteases.8,13,23,33 In addition to IGF-I, several other molecules such as interleukin-1, tumor necrosis factor–α, transforming growth factor–β (TGFβ), retinoic acid, as well as the PI3K/AKT and MAPK/ERK1/2 pathways have been implicated in the regulation of IGFBP-3 expression.12,40,48 The overexpression of some IGFBP isoforms has been well documented in gliomas, in particular, glioblastoma (GBM).15,16,32,43,46 A previous study by our group identified IGFBP-3 as a novel biomarker associated with an adverse GBM prognosis.46 Additionally, IGFBP-3 has been recognized as a hypoxia-induced gene in a study on a malignant glioma cell line (U251).41 IGFBP-3 has also been shown to be overexpressed in several other human cancers, such as melanoma, renal cell carcinoma, and breast and esophageal cancers, suggesting its plausible role in malignancy and progression.6,21,52,59

Earlier studies have shown that IGFBP-3 modulates epidermal growth factor receptor and TGFβ signaling pathways, suggesting a role in the pathogenesis of some human cancers.34,37,52 Interestingly, IGFBP-3 has been shown to regulate signal transducer and activator of transcription 1 (STAT-1) expression during chondrogenesis.49 The STAT proteins were identified primarily as signaling molecules implicated in interferon (IFN)-dependent cellular responses.9,51 In addition to its well-known function in immune surveillance, STAT-1 expression has also been shown to play an important role in tumor pathology.31

So far, there is limited understanding of the biological and mechanistic functions of IGFBP-3 in gliomas. Since our previous study revealed that IGFBP-3 is a novel prognostic biomarker in GBM, in the present study we evaluated the mechanisms of tumor promotion by IGFBP-3 in glioma. We show that IGFBP-3 exerts its protumorigenic actions by regulating cell growth, migration, and invasion. Further, we show STAT-1 regulation by IGFBP-3 in malignant glioma cells, overexpression of STAT-1 in GBM tissue samples, and the association of STAT-1 expression with a poor prognosis in patients with GBM.

Methods

This study was approved by the ethics committees of the National Institute of Mental Health and Neurosciences and the Sri Sathya Sai Institute of Higher Medical Sciences. Fetal bovine serum (FBS), penicillin-streptomycin, and Lipofectamine-2000 were purchased from Invitrogen Life Technologies; Dulbecco's modified Eagle's medium (DMEM), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), and puromycin, from Sigma-Aldrich; dimethyl sulfoxide, from Merck; 29-mer short hairpin (sh)RNA cassette directed against IGFBP-3 and scrambled shRNA (pRFP-C-RS shRNA vector), from OriGene Technologies Inc.; rabbit anti–IGFBP-3 polyclonal antibody, from Santa Cruz Biotechnology; mouse monoclonal anti–β-actin antibody (clone AC-15), anti–rabbit horseradish peroxidase (HRP) secondary antibody, anti–mouse HRP secondary antibody, from Sigma-Aldrich; SuperSignal West Femto Maximum Sensitivity Substrate, from Pierce; Cell Invasion Assay kit, from Chemicon; recombinant (r)IGFBP-3 protein, from Upstate Cell Signaling Solutions; and STAT-1 rabbit monoclonal antibody (clone 42H3), from Cell Signaling Technology.

Patients and Tissue Samples

Nontumor brain tissue samples (controls, n = 30) consisted of a portion of the anterior temporal cortex resected from patients who had undergone surgery for intractable epilepsy. Samples of GBM (n = 136) were obtained from patients who had undergone surgery at two clinical centers (National Institute of Mental Health and Neurosciences and Sri Sathya Sai Institute of Higher Medical Sciences, Bangalore, India). These patients were adults with newly diagnosed GBM who had been prospectively recruited and treated with standard radiochemotherapy. They had undergone macroscopic total or near-total resection of tumor, as confirmed on postoperative MRI, and had a postoperative Karnofsky Performance Scale (KPS) score ≥ 70. They had been subjected to uniform treatment, which included radiotherapy (total dose 59.4 Gy), along with concomitant chemotherapy with temozolomide (100 mg/day, daily for 45 days) and cyclical chemotherapy with temozolomide (150 mg/square meter of body-surface area for 5 days every 28 days). The patients were followed up clinically and with MRI. Overall survival was defined as the time between surgery and the death of the patient from disease. The maximum follow-up period for this cohort was 47 months. Median survival for the whole group was 16 months.

Cell Line Maintenance

The human GBM cell lines U251MG and U87MG were maintained in DMEM supplemented with 10% FBS and penicillin (100 U/ml) in a humidified atmosphere of 5% CO2 at 37°C.

Transfection in U251MG Cell Lines and Generation of Stable Transfectants

Lipofectamine-2000–mediated transfection with 29-mer shRNA cassette directed against IGFBP-3 and vector carrying the scrambled shRNA insert was performed following the manufacturer's protocol. The sequence of the HuSH 29-mer oligonucleotide shRNA of IGFBP-3 insert is GGCTTCTGCTGGTGTGTGGATAAGTATGG. After transfection and incubation for 6 hours, the cells were cultured in DMEM supplemented with 10% FBS. Subsequently, the transfected cells were maintained in the growth medium with 100 ng/ml puromycin to generate stable transfectants. Each colony was trypsinized individually using cloning cylinders to avoid any mixup of clonal populations. Two such IGFBP-3 knockdown clones, designated Clone A and Clone B, along with vector control cells were collected and subcultured in a low concentration of puromycin. These cells were subsequently subjected to immunoblot analysis and cell proliferation, migration, and invasion assays.

Treatment of Cells With IGFBP-3 Protein

The malignant glioma cell lines (U251MG and U87MG) were treated exogenously with 400 ng/ml of rIGFBP-3 protein in the DMEM, and the cells were incubated at 37°C in 5% CO2 atmosphere for 24 hours. Afterward, protein lysates were prepared from the cells and subjected to immunoblot analysis.

Immunoblot Analysis

Expression of IGFBP-3 and STAT-1 was analyzed by immunoblot analysis in IGFBP-3 knockdown clones and vector control cells. The effect of exogenous rIGFBP-3 protein treatment on the expression of STAT-1 was also studied by immunoblot on U251MG and U87MG cell lines. Equal amounts (50 μg) of protein from cells were resolved by 12% SDS-PAGE (sodium dodecyl sulfate–polyacrylamide gel electrophoresis). Proteins were probed with anti–IGFBP-3 antibody (1:1000 dilution), anti–STAT-1 antibody (1:1000). β-actin levels, identified with anti–β-actin antibody (1:2000), served as a normalizing control. Following incubation with an HRP-conjugated secondary antibody (1:2000 dilution), proteins were visualized with a chemiluminescence detection system using the SuperSignal West Femto Maximum Sensitivity Substrate (Pierce) and were subsequently captured on a radiograph.

MTT Cell Proliferation Analysis

To study cell proliferation, an MTT assay was performed.36 Briefly, cells were plated in triplicate into 96-well plates at 5 × 103 cells per well and cultured in 200 μl DMEM supplemented with 10% FBS at 37°C in 5% CO2 for 24 and 48 hours. Afterward, 20 μl of MTT reagent was added, and the cells were incubated at 37°C for 3 hours. Subsequently, DMEM was removed, and the tetrazolium crystals were dissolved in 200 μl of dimethyl sulfoxide and measured at 595 nm. The difference in absorbance between the vector control cells and the IGFBP-3 knockdown clones was calculated to derive the percentage of arrest in cell proliferation.

In Vitro Cell Migration Assay

The role of IGFBP-3 in cell motility and migration was studied using a scratch-wound healing assay. Confluent monolayer cells were scraped using a micropipette tip to generate a scratch wound and were incubated in DMEM with 10% FBS. A series of time frames (6, 12, and 24 hours) of migration pattern at the wound edge were monitored with phase-contrast microscopy using a Leica inverted fluorescence microscope. The images were captured using the Leica Application Suite v3.1.0. At 24 hours, cell numbers were counted from both of the dishes containing IGFBP-3 knockdown clones and vector control cells. The total cell number from the control wells was used as the control to determine the percentage of inhibition of cell migration in the IGFBP-3 knockdown clones.

Matrigel Invasion Assay

The in vitro invasion assay was done using a Cell Invasion Assay kit according to the manufacturer's protocol (Chemicon). In brief, after rehydration of the inserts, IGFBP-3 knockdown cells and vector control cells were plated in the individual inserts at 105 cells/500 μl in serum-free DMEM. Serum-containing DMEM, which served as a chemoattractant, was added to the lower chamber. After incubation for 24 hours at 37°C in 5% CO2, noninvading cells from the interior of the inserts were removed. Adherent invaded cells beneath the chamber were stained with cell stain solution for 20 minutes, and the mean number of cells per chamber was calculated. The cell count of the vector control cells was considered as 100% invasion. The percentage reduction in the invasion capacity of the knockdown cells is depicted as the invasion index.

Real-Time Quantitative Polymerase Chain Reaction (qPCR) Assay

Real-time qPCR was performed on a subset of GBM (n = 73) and control (n = 10) tissue samples. Total RNA was isolated from tissues using TRI reagent (Sigma-Aldrich) per the manufacturer's protocol. Following evaluation of RNA integrity, cDNA was generated from total RNA derived from different tissue samples using the cDNA synthesis kit (Applied Biosystems). Subsequently, real-time qPCR was performed in a ViiA 7 Real-Time PCR system (Applied Biosystems) with the cDNA as template (equivalent to 10 ng of RNA) and gene-specific primer sets for STAT-1 (forward primer = TGGTGAAATTGCAAGAGCTG, reverse primer = AGACTGCCATTGGTGGACTC) using the DyNAmo HS SYBR Green qPCR kit (Thermo Scientific). All measurements were made in duplicate. For normalization, the mean expression levels of ribosomal protein L35a (RP-L35a) were used as internal controls.

Histopathology and Immunohistochemistry (IHC)

Sections of tumor tissues were examined with light microscopy, and the diagnosis of GBM was confirmed.29,30 Immunohistochemistry for STAT-1 was performed on 136 GBM and 30 control tissues. Antigen retrieval was done by heat treatment at 700 W in Tris-EDTA buffer (pH 9). After the initial processing steps, sections were incubated overnight with primary antibody at 4°C (dilution 1:100), followed by incubation with secondary antibody (QD440-XAK, Biogenex), and the reaction was visualized using 3,3′-diaminobenzidine (Sigma-Aldrich) as a chromogenic substrate. A negative control slide in which the primary antibody had been excluded was incorporated with each batch of staining. A visual semiquantitative grading scale was applied to assess the intensity of the immunoreactivity in a manner similar to that in our earlier study on IGFBP isoforms.46 The assessment was as follows: 0 if staining was absent, 1+ if it was weak, and 2+ if it was strong. Only 2+ staining intensity was considered for analysis. The labeling index (LI) was expressed as a percentage of cells that showed 2+ positive staining among the total number of cells that were counted.

Statistical Analyses

For In Vitro Experiments

Data were analyzed using the statistical software GraphPad Prism 5 for in vitro data analysis, and the results were expressed as the mean ± standard deviation. The SPSS 15.0 statistical software was used for clinical data analysis, and the results were expressed as the median (mean ± standard deviation). A p value < 0.05 was considered significant, and all exact 2-sided p values were reported.

For Comparison of mRNA and Protein Expression of STAT-1 Between GBM and Control Tissues

All continuous variables were tested for normal distribution and were found to be nonnormal. To compare the difference in expression of STAT-1 (mRNA and protein) between GBM and control tissue, a nonparametric Mann-Whitney test was used.

For Correlation of STAT-1 and IGFBP-3 Protein Expression With Survival in Patients With Newly Diagnosed GBM

Expression of STAT-1 and IGFBP-3 protein was correlated with survival in this patient cohort. Since the other clinical factors like the extent of resection and postoperative KPS score were standardized per the inclusion criteria, the only clinical variable included for analysis was patient age. The significance of continuous variables was assessed using univariate Cox regression models. The variables that were significant on univariate analysis (p ≤ 0.1) were subjected to multivariate analysis. Results were reported using the p value and estimated hazard ratio along with the 95% confidence intervals. A p value < 0.05 was considered significant, and all exact 2-sided p values were reported. Furthermore, yearly survival probabilities, with the presence or absence of STAT-I expression, were calculated among patients with newly diagnosed GBM by using the Kaplan-Meier life table method.

Results

Immunoblot and Effect of IGFBP-3 Knockdown on GBM Tumor Cell Proliferation Analysis

To gain insight into the functional significance of IGFBP-3 expression in vitro, stable transfectants of IGFBP-3 knockdown clones and vector control cells were generated using a gene knockdown approach in U251MG cells. As shown in (Fig. 1A), the knockdown of IGFBP-3 expression in both of the clones (Clones A and B) was evident on immunoblot analysis. To determine the effect of IGFBP-3 on cell proliferation, an MTT assay was performed using IGFBP-3 knockdown clones and vector control cells. Knockdown of IGFBP-3 expression resulted in significantly lower cell viability of approximately 50% compared with vector control cells. At 24 hours, the median (mean ± SD) optical density (OD) for the knockdown Clones A and B were 0.3115 (0.3123 ± 0.0142) and 0.2985 (0.3038 ± 0.0190), respectively. The difference in the OD ratios between the knockdown clones and the vector controls (0.6475 [0.6760 ± 0.0730]) was statistically significant (p < 0.0001; Fig. 1B).

Fig. 1.
Fig. 1.

A: IGFBP-3 protein expression using immunoblot analysis. β-Actin was used as a loading control. The IGFBP-3 knockdown clones (both Clones A and B) showed a drastic reduction in the expression of IGFBP-3 as compared with the vector control cells. B: In vitro tumor proliferation analysis by MTT assay. One-way ANOVA followed by Bonferroni's post hoc multiple comparison tests showed a statistically significant decrease in tumor cell proliferative capacity of the IGFBP-3 knockdown clones (both Clones A and B) compared with the vector control cells at an incubation time of 24 hours (p < 0.0001). C: In vitro cell motility and migration assay. The average migrated cell number (500 ± 10 cells) in the vector control was set as 100%. The IGFBP-3 knockdown clones showed a significant reduction in cell migration. The average number of cells migrating in the knockdown Clones A and B were 30 ± 10 cells and 20 ± 10 cells, respectively, which account for approximately 6.0% ± 2% and 4.0% ± 2% of the vector control cells. Original magnification ×80. D: In vitro cell invasion assay. The invasive capacity of U251MG cells in the IGFBP-3 knockdown clones was markedly impaired by more than 80% compared with vector control cells. Insets represent the cells used for counting the number of cells invaded. Small arrows indicate the cells invaded. O.D. = optical density values.

Effect of IGFBP-3 Knockdown on GBM Tumor Cell Migration

To evaluate the effect of IGFBP-3 on cell motility and migration, a scratch-wound healing assay was performed using IGFBP-3 knockdown clones and vector control cells. A series of time frames (6, 12, and 24 hours) of migration pattern at the wound edge were monitored using phase-contrast microscopy. Cell numbers from three separate image fields were counted within the gap area at 24 hours. The average cell number (500 ± 10 cells) in the vector control cells was set as 100%, and the IGFBP-3 knockdown Clones A (30 ± 10 cells) and B (20 ± 10 cells) were approximately 6.0% ± 2% and 4.0% ± 2%, respectively, of the control cells (Fig. 1C). This suggests that decreasing IGFBP-3 expression significantly impairs the motility and migration capacity (> 95%) of U251MG cells in vitro.

Effect of IGFBP-3 Knockdown on GBM Tumor Cell Invasion in Vitro

To investigate if IGFBP-3 influences GBM tumor cell invasion, we performed the Matrigel invasion assay by using IGFBP-3 knockdown clones and vector control cells. Our results showed that decreasing IGFBP-3 gene expression significantly impairs the invasive capacity of U251MG cells in vitro by more than 80% compared with vector control cells (Fig. 1D).

IGFBP-3 Regulates the Expression of STAT-1 in Malignant Glioma Cells

In a previous report, STAT-1 regulation by IGFBP-3 in the context of early chondrogenesis was demonstrated.49 Moreover, the role of STAT-1 in the pathogenesis of other cancers has been well established.1,14,18,22,28,47,50 Since our previous studies have suggested protumorigenic actions of IGFBP-3 in GBM, it is possible that this action may involve STAT-1 regulation. To test this hypothesis, IGFBP-3 knockdown clones and vector control cells were analyzed for STAT-1 protein expression by immunoblot analysis. As shown in Fig. 2A, IGFBP-3 knockdown clones had significantly reduced STAT-1 protein expression. Additionally, immunoblot analysis demonstrated that the exogenous addition of rIGFBP-3 protein increased the levels of STAT-1 protein in U251MG and U87MG cells (Fig. 2B and C), in comparison with levels in the untreated cells. These experiments confirmed our hypothesis that IGFBP-3 regulates STAT-1 expression in malignant glioma cells.

Fig. 2.
Fig. 2.

IGFBP-3 regulation of STAT-1 expression in malignant glioma cells. A: STAT-1 expression was suppressed upon IGFBP-3 knockdown. B and C: STAT-1 expression was upregulated in U251MG and U87MG cells upon the exogenous addition of rIGFBP-3 protein, as compared with levels in untreated cells.

mRNA and Protein Expression Pattern of STAT-1 in GBM and Control Tissues

In view of the influence of IGFBP-3 on STAT-1 expression in glioma cell lines, we studied the mRNA and protein expression pattern of STAT-1 in human GBM and control samples by using real-time qPCR and IHC. The median (mean ± SD) log2 ratio of STAT-1 mRNA expression was 0.03663 (0.0004 ± 0.5722) in control tissues and 0.8533 (0.9551 ± 2.017) in GBM tissues.

The mRNA expression of STAT-1 demonstrated statistically significant (p = 0.0239) overexpression in GBM tissues, as compared with controls, with a median fold change (log2) of 0.853 on the Mann-Whitney test (Fig. 3 upper).

Fig. 3.
Fig. 3.

mRNA and protein expression pattern of STAT-1 in control and GBM tissues. Upper: Significant (p = 0.0239) overexpression of STAT-1 mRNA in GBM, as compared with control brain tissues, with a median fold change (log2) of 0.853. Lower: Statistically significant difference (p < 0.001) in the median LI for STAT-1 cytoplasmic expression between GBM (LI = 15.00) and control (LI = 0.00) tissues.

For STAT-1 protein expression according to IHC, we considered only cytoplasmic staining for analysis, which is in line with a previous report.20 The median (mean ± SD) LI for STAT-1 cytoplasmic expression in GBM was 15.00 (14.92 ± 13.85); in controls, 0.00 (0.00 ± 0.00). The difference in STAT-1 protein expression between GBM and control tissues was statistically significant (p < 0.001; Fig. 3 lower).

Representative micrographs of STAT-1 protein expression in control and GBM tissues are shown in Fig. 4. Control brain tissue sections stained negatively (Fig. 4A). In GBMs, staining was predominantly confined to the cytoplasm of neoplastic astrocytes. In approximately two-thirds of the cases, concomitant nuclear staining was also observed. Heterogeneity of staining was noted within individual tumor samples (Fig. 4B and C). Large atypical tumor astrocytes, tumor giant cells (Fig. 4B), perivascular cells (Fig. 4D), and cells infiltrating the adjacent cortex showed strong staining.

Fig. 4.
Fig. 4.

Immunohistochemical staining pattern of STAT-1 in GBM and control tissues. STAT-1 expression is not seen in the control white matter (A), while several cells of GBM are stained (B and C), including tumor giant cells (B) and perivascular cells (D). Both cytoplasmic and nuclear staining are visible. Original magnifications ×160 (A–C), ×80 (D).

Effect of STAT-1 and IGFBP-3 Protein Expression on Survival in Patients With Newly Diagnosed GBM

We then studied the effect of STAT-1 and IGFBP-3 protein expression on the prognosis of newly diagnosed GBM. Univariate Cox regression models revealed that STAT-1 protein expression (HR 1.017, p = 0.013, 95% CI 1.004–1.031) and patient age (HR 1.026, p = 0.002, 95% CI 1.009–1.043) were associated with shorter survival in this prospective cohort of patients with GBM; however, IGFBP-3 expression did not significantly correlate with survival (HR 1.013, p = 0.118, 95% CI 0.997–1.029; Table 1). For clinical significance, a cutoff of 10% STAT-1 LI was considered to indicate a tumor as positively stained. The median survival of patients with tumors negative for STAT-1 was 21 months (95% CI 13.6–28.4 months), whereas that of patients with STAT-1–positive tumors was 13 months (95% CI 11.2–14.8 months), with the difference being statistically significant (p = 0.008; Fig. 5).

Fig. 5.
Fig. 5.

Kaplan-Meier survival estimates for GBM patients are calculated for STAT-1 expression. The median survival of patients with tumors negative for STAT-1 was 21 months, while those with tumors positive for STAT-1 was 13 months; the difference was statistically significant (p = 0.008).

TABLE 1:

Survival analysis using univariate and multivariate Cox regression models*

VariableHR (95% CI)p Value
univariate analysis
 STAT-1 LI1.017 (1.004–1.031)0.013
 IGFBP-3 LI1.013 (0.997 1.029)0.118
 patient age1.026 (1.009 1.043)0.002
multivariate analysis
 STAT-1 LI1.015 (1.001 1.029)0.033
 patient age1.025 (1.008–1.042)0.005

STAT-1 protein expression and age are significantly associated with poor prognosis (p < 0.05) on both univariate and multivariate Cox regression analysis. Boldface values are statistically significant.

The variables of patient age and STAT-1 LI were associated with survival on univariate analysis at the predetermined significance level of 0.1 and were therefore included in the multivariate Cox model. On performing the multivariate Cox regression analysis, it was observed that patient age (HR 1.025, p = 0.005, 95% CI 1.008–1.042) and STAT-1 protein expression (HR 1.015, p = 0.033, 95% CI 1.001–1.029) were independent predictors of a poor outcome in GBM patients (Table 1).

We also noted that STAT-1 expression had an influence on the long-term survival of GBM patients. The 3-year survival rate was only 12% in patients with STAT-1 overexpression compared with 30% in patients with negative STAT-1 expression.

Discussion

The results of our previous study showed that IGFBP-3 is an adverse prognostic biomarker in GBM patients.46 In the present study, the influence of IGFBP-3 expression on GBM tumor cell proliferation, migration, and invasion was analyzed in human U251MG cells in vitro by using a shRNA-based gene knockdown approach. A concomitant reduction of nearly 50% in cell proliferation and more than 95% in cell motility and migration capacity observed following IGFBP-3 knockdown strengthens its hypothetical role in GBM pathogenesis and progression. Moreover, the invasive capacity of the IGFBP-3 knockdown clones was markedly reduced by more than 80%, compared with vector control cells, reflecting the influence of IGFBP-3 on the invasive capability of GBM cells. Interestingly, IGFBP-3 has been shown to possess a bidirectional role in tumor behavior: proapoptotic/antiproliferative or growth stimulatory.19,37,42,53 Our findings accord with those in a previous study showing the growth-stimulatory effects of IGFBP-3 in MCF-10A mammary epithelial cells.34 The involvement of IGFBP-3 in migration and invasion are less well documented. Similar to our findings, which showed that IGFBP-3 is involved in malignant glioma cell motility and migration, an earlier report has shown that IGFBP-3 is essential for the migration of melanoma cells.59 On the contrary, some studies have shown IGFBP-3 significantly reduces the migration of PC3 prostate cancer cells, Ewing's sarcoma cells, and non–small cell lung cancers, further emphasizing the multifunctional roles of IGFBP-3 in different human cancers.4,35,38 Our results demonstrating IGFBP-3's involvement in GBM tumor cell invasion in vitro are also consistent with the findings of previous studies on malignant melanoma and esophageal squamous cell carcinoma.37,59 In contrast, other studies on ovarian, prostate, and lung carcinomas have demonstrated that IGFBP-3 inhibits cell invasion in vitro.4,35,38,53 Taken together, IGFBP-3 actions in tumorigenesis are context dependent.

IGFBP-3 could play a role in GBM pathogenesis that could be performed through several potential mechanisms. It could exert its action through an IGF-dependent pathway, recruiting IGF-1 and IGF-2 to the tumor microenvironment, or through an IGF-independent pathway via molecules such as TGFβ, as recently demonstrated in breast cancers.17,25 A literature search for similar such molecules yielded an interesting one, STAT-1, which is regulated by IGFBP-3 during early chondrogenesis.49

There are 7 STAT proteins, and among these, STAT-1 is known to be activated not only by cytokines but also by growth factors, such as epidermal growth factor, platelet-derived growth factor, insulin, and IGF-1.5,39 STAT-1 expression has been described in various malignancies including leukemia, renal cell carcinoma, head and neck tumors, breast cancer, and melanoma.1,14,18,22,28,47,50 STAT-1 has also been reported to promote tumor aggressiveness by rendering the cells resistant to ionizing radiation.11,26,27 In the present study, we showed that IGFBP-3 regulates the expression of STAT-1 in malignant glioma cells (U251MG and U87MG cells) when treated with rIGFBP-3 protein. Further, the suppression of STAT-1 expression was unequivocally established by knockdown of IGFBP-3. These data suggest a functional role for STAT-1 in IGFBP-3–mediated protumorigenic actions.

After establishing the regulation of STAT-1 by IGFBP-3 through in vitro experiments, we demonstrated the overexpression of STAT-1 mRNA and protein in GBM as compared with levels in control tissues. While no studies have detailed the mRNA expression of STAT-1 in GBM tissues, a report on a small set of GBM samples has revealed increased protein expression of STAT-1 in about 48% of tumors.20 In our study we noted positive staining in 61% of tumors via IHC. STAT-1 staining was heterogeneous in GBM tissues. Even though the staining was predominantly confined to the cytoplasm of neoplastic astrocytes, in about two-thirds of the cases, we noted concomitant nuclear staining. This finding contrasts with that in a previous study, in which the authors observed only cytoplasmic staining, which was attributed to a probable inactivation of protein leading to the immune escape of tumor cells.20 Interestingly, the tumor cells in the perivascular region and those infiltrating the adjacent cortex were intensely labeled, indicating a role for STAT-1 in tumor cell invasion.

We then assessed the influence of STAT-1 protein expression on the prognosis of GBM and noted that STAT-1 was significantly associated with shorter survival according to univariate Cox regression and Kaplan-Meier analyses.

A multivariate Cox proportional hazards model showed that STAT-1 expression and patient age were independently associated with a worse clinical outcome in GBM patients. In our earlier study IGFBP-3 protein expression showed a survival correlation in GBM patients;46 however, extended follow-up of the same patient cohort revealed that IGFBP-3 lost its prognostic significance, while STAT-1 expression and patient age were associated with shorter patient survival. Although we have demonstrated that IGFBP-3 regulates STAT-1 expression in glioma cells, it is also likely that other molecules can regulate STAT-1, placing STAT-1, as compared with IGFBP-3, as a key molecule influencing the survival of GBM patients with a longer follow-up. In support of this hypothesis, we have also shown that STAT-1 expression had an influence on the long-term survival rates of GBM patients. The 3-year survival rate was only 12% in patients with tumors positive for STAT-1, as compared with 30% in patients with tumors negative for STAT-1.

Taken together, our observations support the contention that STAT-1 expression has a significant influence on the survival of GBM patients. There is only one report that has shown that the expression of IFN/STAT-1 signaling genes predicts a poor survival outcome in the proneural subgroup of GBM patients. Authors of that report hypothesized that the poor prognosis could be attributable to the chemoresistance and/or radiation resistance of tumors that express STAT-1.10 Work on other tumors and cell lines has shown that, like IGFBP-3, STAT-1 also has a dual role in cancer. For example, the overexpression of STAT-1 has been associated with a better outcome in squamous cell carcinoma and mammary cancers.2,57,58

Interestingly, contrary to our observations, a recent study has shown the decreased expression of STAT-1 protein in GBMs.24 Authors of that study also observed that transfection of the U87MG cells with STAT-1 plasmid in vitro significantly inhibited cell growth and increased apoptotic cell death, and thus they attributed a antitumorigenic role to STAT-1. Another study points toward a protumorigenic role of STAT-1 in GBM.10 These contradictory reports of STAT-1 in GBM make it an interesting molecule for further detailed analysis.

Conclusions

In summary, the present study highlights the critical role of IGFBP-3 in GBM pathogenesis and progression by facilitating tumor cell proliferation, invasion, and migration. IGFBP-3 regulates STAT-1 in malignant glioma cells, and STAT-1 is overexpressed in GBM tissues. Further, STAT-1 has been identified as a molecule strongly associated with a poor prognosis in GBM, with an incompletely understood biological role, and thus making it an interesting molecule for further exploration.

Acknowledgments

We acknowledge M.R.S. Rao, Jawaharlal Nehru Centre for Advanced Scientific Research, and K. Somasundaram, Indian Institute of Science, for their support and guidance; and we thank all project assistants working on the NMITLI and DBT project for their help with the collection of tumor samples, patient coordination, and technical assistance. Special thanks to Sudhanshu K. Shukla, Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore, for carrying out the real-time PCR experiments.

Disclosure

The authors report no conflict of interest concerning the materials or methods used in this study or the findings specified in this paper. This study was partially funded by the NMITLI program of the Council of Scientific and Industrial Research (CSIR) and Department of Biotechnology (DBT) India.

Author contributions to the study and manuscript preparation include the following. Conception and design: Santosh, Thota, Kondaiah. Acquisition of data: Thota, Arimappamagan. Analysis and interpretation of data: Santosh, Thota, Arimappamagan, Shastry, Hegde, Kondaiah. Drafting the article: Thota. Critically revising the article: all authors. Reviewed submitted version of manuscript: all authors. Approved the final version of the manuscript on behalf of all authors: Santosh. Statistical analysis: Santosh, Kandavel. Administrative/technical/material support: Santosh, Kondaiah. Study supervision: Santosh, Chandramouli, Hegde, Kondaiah.

This article contains some figures that are displayed in color online but in black-and-white in the print edition.

References

  • 1

    Arany IChen SHMegyesi JKAdler-Storthz KChen ZRajaraman S: Differentiation-dependent expression of signal transducers and activators of transcription (STATs) might modify responses to growth factors in the cancers of the head and neck. Cancer Lett 199:83892003

  • 2

    Battle TEWierda WGRassenti LZZahrieh DNeuberg DKipps TJ: In vivo activation of signal transducer and activator of transcription 1 after CD154 gene therapy for chronic lymphocytic leukemia is associated with clinical and immunologic response. Clin Cancer Res 9:216621722003

  • 3

    Baxter RC: Signalling pathways involved in antiproliferative effects of IGFBP-3: a review. Mol Pathol 54:1451482001

  • 4

    Benini SZuntini MManara MCCohen PNicoletti GNanni P: Insulin-like growth factor binding protein 3 as an anticancer molecule in Ewing's sarcoma. Int J Cancer 119:103910462006

  • 5

    Brivanlou AHDarnell JE Jr: Signal transduction and the control of gene expression. Science 295:8138182002

  • 6

    Burger AMLeyland-Jones BBanerjee KSpyropoulos DDSeth AK: Essential roles of IGFBP-3 and IGFBP-rP1 in breast cancer. Eur J Cancer 41:151515272005

  • 7

    Ciampolillo ADe Tullio CGiorgino F: The IGF-I/IGF-I receptor pathway: implications in the Pathophysiology of Thyroid Cancer. Curr Med Chem 12:288128912005

  • 8

    Coverley JAMartin JLBaxter RC: The effect of phosphorylation by casein kinase 2 on the activity of insulin-like growth factor-binding protein-3. Endocrinology 141:5645702000

  • 9

    Darnell JE Jr: STATs and gene regulation. Science 277:163016351997

  • 10

    Duarte CWWilley CDZhi DCui XHarris JJVaughan LK: Expression signature of IFN/STAT1 signaling genes predicts poor survival outcome in glioblastoma multiforme in a subtype-specific manner. PLoS ONE 7:e296532012

  • 11

    Efimova EVLiang HPitroda SPLabay EDarga TELevina V: Radioresistance of Stat1 over-expressing tumour cells is associated with suppressed apoptotic response to cytotoxic agents and increased IL6-IL8 signalling. Int J Radiat Biol 85:4214312009

  • 12

    Firth SMBaxter RC: Cellular actions of the insulin-like growth factor binding proteins. Endocr Rev 23:8248542002

  • 13

    Firth SMBaxter RC: Characterisation of recombinant glycosylation variants of insulin-like growth factor binding protein-3. J Endocrinol 160:3793871999

  • 14

    Fryknäs MDhar SOberg FRickardson LRydåker MGöransson H: STAT1 signaling is associated with acquired crossresistance to doxorubicin and radiation in myeloma cell lines. Int J Cancer 120:1891952007

  • 15

    Fukushima TKataoka H: Roles of insulin-like growth factor binding protein-2 (IGFBP-2) in glioblastoma. Anticancer Res 27:6A368536922007

  • 16

    Fuller GNRhee CHHess KRCaskey LSWang RBruner JM: Reactivation of insulin-like growth factor binding protein 2 expression in glioblastoma multiforme: a revelation by parallel gene expression profiling. Cancer Res 59:422842321999

  • 17

    Giles EDSingh G: Role of insulin-like growth factor binding proteins (IGFBPs) in breast cancer proliferation and metastasis. Clin Exp Metastasis 20:4814872003

  • 18

    Gouilleux-Gruart VGouilleux FDesaint CClaisse JFCapiod JCDelobel J: STAT-related transcription factors are constitutively activated in peripheral blood cells from acute leukemia patients. Blood 87:169216971996

  • 19

    Gui YMurphy LJ: Interaction of insulin-like growth factor binding protein-3 with latent transforming growth factor-beta binding protein-1. Mol Cell Biochem 250:1891952003

  • 20

    Haybaeck JObrist PSchindler CUSpizzo GDoppler W: STAT-1 expression in human glioblastoma and peritumoral tissue. Anticancer Res 27:6B382938352007

  • 21

    Hintz RLBock SThorsson AVBovens JPowell DRJakse G: Expression of the insulin like growth factor-binding protein 3 (IGFBP-3) gene is increased in human renal carcinomas. J Urol 146:116011631991

  • 22

    Hui ZTretiakova MZhang ZLi YWang XZhu JX: Radiosensitization by inhibiting STAT1 in renal cell carcinoma. Int J Radiat Oncol Biol Phys 73:2882952009

  • 23

    Jones JID'Ercole AJCamacho-Hubner CClemmons DR: Phosphorylation of insulin-like growth factor (IGF)-binding protein 1 in cell culture and in vivo: effects on affinity for IGF-I. Proc Natl Acad Sci U S A 88:748174851991

  • 24

    Ju HLi XLi HWang XWang HLi Y: Mediation of multiple pathways regulating cell proliferation, migration, and apoptosis in the human malignant glioma cell line U87MG via unphosphorylated STAT1. Laboratory investigation. J Neurosurg 118:123912472013

  • 25

    Kelley KMOh YGargosky SEGucev ZMatsumoto THwa V: Insulin-like growth factor-binding proteins (IGFBPs) and their regulatory dynamics. Int J Biochem Cell Biol 28:6196371996

  • 26

    Khodarev NNBeckett MLabay EDarga TRoizman BWeichselbaum RR: STAT1 is overexpressed in tumors selected for radioresistance and confers protection from radiation in transduced sensitive cells. Proc Natl Acad Sci U S A 101:171417192004

  • 27

    Khodarev NNMinn AJEfimova EVDarga TELabay EBeckett M: Signal transducer and activator of transcription 1 regulates both cytotoxic and prosurvival functions in tumor cells. Cancer Res 67:921492202007

  • 28

    Khodarev NNRoach PPitroda SPGolden DWBhayani MShao MY: STAT1 pathway mediates amplification of metastatic potential and resistance to therapy. PLoS ONE 4:e58212009

  • 29

    Kleihues PLouis DNScheithauer BWRorke LBReifenberger GBurger PC: The WHO classification of tumors of the nervous system. J Neuropathol Exp Neurol 61:2152292002

  • 30

    Kleihues PLouis DNWiestler ODBurger PCSchiethauer BWWHO grading of tumors of central nervous system. Louis DNOhgaki HWiestler ODCavenee WK: WHO Classification of Tumors of the Central Nervous System ed 4LyonIARC Press2007. 1011

  • 31

    Kovacic BStoiber DMoriggl RWeisz EOtt RGKreibich R: STAT1 acts as a tumor promoter for leukemia development. Cancer Cell 10:77872006

  • 32

    Kulkarni AThota BSrividya MRThennarasu KArivazhagan ASantosh V: Expression pattern and prognostic significance of IGFBP isoforms in anaplastic astrocytoma. Pathol Oncol Res 18:9619672012

  • 33

    Marinaro JANeumann GMRusso VCLeeding KSBach LA: O-glycosylation of insulin-like growth factor (IGF) binding protein-6 maintains high IGF-II binding affinity by decreasing binding to glycosaminoglycans and susceptibility to proteolysis. Eur J Biochem 267:537853862000

  • 34

    Martin JLWeenink SMBaxter RC: Insulin-like growth factor-binding protein-3 potentiates epidermal growth factor action in MCF-10A mammary epithelial cells. Involvement of p44/42 and p38 mitogen-activated protein kinases. J Biol Chem 278:296929762003

  • 35

    Massoner PColleselli DMatscheski APircher HGeley SJansen Dürr P: Novel mechanism of IGF-binding protein-3 action on prostate cancer cells: inhibition of proliferation, adhesion, and motility. Endocr Relat Cancer 16:7958082009

  • 36

    Mosmann T: Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 65:55631983

  • 37

    Natsuizaka MOhashi SWong GSAhmadi AKalman RABudo D: Insulin-like growth factor-binding protein-3 promotes transforming growth factor-beta1-mediated epithelial-to-mesenchymal transition and motility in transformed human esophageal cells. Carcinogenesis 31:134413532010

  • 38

    Oh SHLee OHSchroeder CPOh YWKe SCha HJ: Antimetastatic activity of insulin-like growth factor binding protein-3 in lung cancer is mediated by insulin-like growth factor-independent urokinase-type plasminogen activator inhibition. Mol Cancer Ther 5:268526952006

  • 39

    O'Shea JJGadina MSchreiber RD: Cytokine signaling in 2002: new surprises in the Jak/Stat pathway. Cell 109:SupplS121S1312002

  • 40

    Oy GFSlipicevic ADavidson BSolberg Faye RMaelandsmo GMFlørenes VA: Biological effects induced by insulinlike growth factor binding protein 3 (IGFBP-3) in malignant melanoma. Int J Cancer 126:3503612010

  • 41

    Ragel BTCouldwell WTGillespie DLJensen RL: Identification of hypoxia-induced genes in a malignant glioma cell line (U-251) by cDNA microarray analysis. Neurosurg Rev 30:1811872007

  • 42

    Rajah RValentinis BCohen P: Insulin-like growth factor (IGF)-binding protein-3 induces apoptosis and mediates the effects of transforming growth factor-beta1 on programmed cell death through a p53- and IGF-independent mechanism. J Biol Chem 272:12181121881997

  • 43

    Reddy SPBritto RVinnakota KAparna HSreepathi HKThota B: Novel glioblastoma markers with diagnostic and prognostic value identified through transcriptome analysis. Clin Cancer Res 14:297829872008

  • 44

    Riedemann JMacaulay VM: IGF1R signalling and its inhibition. Endocr Relat Cancer 13:Suppl 1S33S432006

  • 45

    Rosenfeld RGHwa VWilson EPlymate SROh Y: The insulin-like growth factor-binding protein superfamily. Growth Horm IGF Res 10:Suppl AS16S172000

  • 46

    Santosh VArivazhagan ASreekanthreddy PSrinivasan HThota BSrividya MR: Grade-specific expression of insulin-like growth factor-binding proteins-2, -3, and -5 in astrocytomas: IGFBP-3 emerges as a strong predictor of survival in patients with newly diagnosed glioblastoma. Cancer Epidemiol Biomarkers Prev 19:139914082010

  • 47

    Sheen-Chen SMHuang CCTang RPYang CHChou FFEng HL: Signal transducer and activator of transcription 1 in breast cancer: analysis with tissue microarray. Anticancer Res 27:4B248124862007

  • 48

    Sivaprasad UFleming JVerma PSHogan KADesury GCohick WS: Stimulation of insulin-like growth factor (IGF) binding protein-3 synthesis by IGF-I and transforming growth factor-alpha is mediated by both phosphatidylinositol-3 kinase and mitogen-activated protein kinase pathways in mammary epithelial cells. Endocrinology 145:421342212004

  • 49

    Spagnoli ATorello MNagalla SRHorton WAPattee PHwa V: Identification of STAT-1 as a molecular target of IGFBP-3 in the process of chondrogenesis. J Biol Chem 277:18860188672002

  • 50

    Sreekumar ANyati MKVarambally SBarrette TRGhosh DLawrence TS: Profiling of cancer cells using protein microarrays: discovery of novel radiation-regulated proteins. Cancer Res 61:758575932001

  • 51

    Stark GR: How cells respond to interferons revisited: from early history to current complexity. Cytokine Growth Factor Rev 18:4194232007

  • 52

    Takaoka MHarada HAndl CDOyama KNaomoto YDempsey KL: Epidermal growth factor receptor regulates aberrant expression of insulin-like growth factor-binding protein 3. Cancer Res 64:771177232004

  • 53

    Torng PLLee YCHuang CYYe JHLin YSChu YW: Insulin-like growth factor binding protein-3 (IGFBP-3) acts as an invasion-metastasis suppressor in ovarian endometrioid carcinoma. Oncogene 27:213721472008

  • 54

    Trojan JCloix JFArdourel MYChatel MAnthony DD: Insulin-like growth factor type I biology and targeting in malignant gliomas. Neuroscience 145:7958112007

  • 55

    Vincent AMFeldman EL: Control of cell survival by IGF signaling pathways. Growth Horm IGF Res 12:1931972002

  • 56

    Wang HFuller GNZhang WInsulin-like growth factors and insulin-like growth factor binding proteins in CNS tumors. Zhang WFuller GN: Genomic and Molecular Neuro-Oncology Sudbury, MAJones and Bartlett2004. 119130

  • 57

    Widschwendter ATonko-Geymayer SWelte TDaxenbichler GMarth CDoppler W: Prognostic significance of signal transducer and activator of transcription 1 activation in breast cancer. Clin Cancer Res 8:306530742002

  • 58

    Xi SDyer KFKimak MZhang QGooding WEChaillet JR: Decreased STAT1 expression by promoter methylation in squamous cell carcinogenesis. J Natl Cancer Inst 98:1811892006

  • 59

    Xi YNakajima GHamil TFodstad ORiker AJu J: Association of insulin-like growth factor binding protein-3 expression with melanoma progression. Mol Cancer Ther 5:307830842006

If the inline PDF is not rendering correctly, you can download the PDF file here.

Article Information

Drs. Santosh and Kondaiah contributed equally to this work.

Address correspondence to: Vani Santosh, M.D., Department of Neuropathology, National Institute of Mental Health and Neurosciences, Bangalore-560029, India. email: vani.santosh@gmail.com.

Please include this information when citing this paper: published online May 30, 2014; DOI: 10.3171/2014.4.JNS131198.

© AANS, except where prohibited by US copyright law.

Headings

Figures

  • View in gallery

    A: IGFBP-3 protein expression using immunoblot analysis. β-Actin was used as a loading control. The IGFBP-3 knockdown clones (both Clones A and B) showed a drastic reduction in the expression of IGFBP-3 as compared with the vector control cells. B: In vitro tumor proliferation analysis by MTT assay. One-way ANOVA followed by Bonferroni's post hoc multiple comparison tests showed a statistically significant decrease in tumor cell proliferative capacity of the IGFBP-3 knockdown clones (both Clones A and B) compared with the vector control cells at an incubation time of 24 hours (p < 0.0001). C: In vitro cell motility and migration assay. The average migrated cell number (500 ± 10 cells) in the vector control was set as 100%. The IGFBP-3 knockdown clones showed a significant reduction in cell migration. The average number of cells migrating in the knockdown Clones A and B were 30 ± 10 cells and 20 ± 10 cells, respectively, which account for approximately 6.0% ± 2% and 4.0% ± 2% of the vector control cells. Original magnification ×80. D: In vitro cell invasion assay. The invasive capacity of U251MG cells in the IGFBP-3 knockdown clones was markedly impaired by more than 80% compared with vector control cells. Insets represent the cells used for counting the number of cells invaded. Small arrows indicate the cells invaded. O.D. = optical density values.

  • View in gallery

    IGFBP-3 regulation of STAT-1 expression in malignant glioma cells. A: STAT-1 expression was suppressed upon IGFBP-3 knockdown. B and C: STAT-1 expression was upregulated in U251MG and U87MG cells upon the exogenous addition of rIGFBP-3 protein, as compared with levels in untreated cells.

  • View in gallery

    mRNA and protein expression pattern of STAT-1 in control and GBM tissues. Upper: Significant (p = 0.0239) overexpression of STAT-1 mRNA in GBM, as compared with control brain tissues, with a median fold change (log2) of 0.853. Lower: Statistically significant difference (p < 0.001) in the median LI for STAT-1 cytoplasmic expression between GBM (LI = 15.00) and control (LI = 0.00) tissues.

  • View in gallery

    Immunohistochemical staining pattern of STAT-1 in GBM and control tissues. STAT-1 expression is not seen in the control white matter (A), while several cells of GBM are stained (B and C), including tumor giant cells (B) and perivascular cells (D). Both cytoplasmic and nuclear staining are visible. Original magnifications ×160 (A–C), ×80 (D).

  • View in gallery

    Kaplan-Meier survival estimates for GBM patients are calculated for STAT-1 expression. The median survival of patients with tumors negative for STAT-1 was 21 months, while those with tumors positive for STAT-1 was 13 months; the difference was statistically significant (p = 0.008).

References

  • 1

    Arany IChen SHMegyesi JKAdler-Storthz KChen ZRajaraman S: Differentiation-dependent expression of signal transducers and activators of transcription (STATs) might modify responses to growth factors in the cancers of the head and neck. Cancer Lett 199:83892003

  • 2

    Battle TEWierda WGRassenti LZZahrieh DNeuberg DKipps TJ: In vivo activation of signal transducer and activator of transcription 1 after CD154 gene therapy for chronic lymphocytic leukemia is associated with clinical and immunologic response. Clin Cancer Res 9:216621722003

  • 3

    Baxter RC: Signalling pathways involved in antiproliferative effects of IGFBP-3: a review. Mol Pathol 54:1451482001

  • 4

    Benini SZuntini MManara MCCohen PNicoletti GNanni P: Insulin-like growth factor binding protein 3 as an anticancer molecule in Ewing's sarcoma. Int J Cancer 119:103910462006

  • 5

    Brivanlou AHDarnell JE Jr: Signal transduction and the control of gene expression. Science 295:8138182002

  • 6

    Burger AMLeyland-Jones BBanerjee KSpyropoulos DDSeth AK: Essential roles of IGFBP-3 and IGFBP-rP1 in breast cancer. Eur J Cancer 41:151515272005

  • 7

    Ciampolillo ADe Tullio CGiorgino F: The IGF-I/IGF-I receptor pathway: implications in the Pathophysiology of Thyroid Cancer. Curr Med Chem 12:288128912005

  • 8

    Coverley JAMartin JLBaxter RC: The effect of phosphorylation by casein kinase 2 on the activity of insulin-like growth factor-binding protein-3. Endocrinology 141:5645702000

  • 9

    Darnell JE Jr: STATs and gene regulation. Science 277:163016351997

  • 10

    Duarte CWWilley CDZhi DCui XHarris JJVaughan LK: Expression signature of IFN/STAT1 signaling genes predicts poor survival outcome in glioblastoma multiforme in a subtype-specific manner. PLoS ONE 7:e296532012

  • 11

    Efimova EVLiang HPitroda SPLabay EDarga TELevina V: Radioresistance of Stat1 over-expressing tumour cells is associated with suppressed apoptotic response to cytotoxic agents and increased IL6-IL8 signalling. Int J Radiat Biol 85:4214312009

  • 12

    Firth SMBaxter RC: Cellular actions of the insulin-like growth factor binding proteins. Endocr Rev 23:8248542002

  • 13

    Firth SMBaxter RC: Characterisation of recombinant glycosylation variants of insulin-like growth factor binding protein-3. J Endocrinol 160:3793871999

  • 14

    Fryknäs MDhar SOberg FRickardson LRydåker MGöransson H: STAT1 signaling is associated with acquired crossresistance to doxorubicin and radiation in myeloma cell lines. Int J Cancer 120:1891952007

  • 15

    Fukushima TKataoka H: Roles of insulin-like growth factor binding protein-2 (IGFBP-2) in glioblastoma. Anticancer Res 27:6A368536922007

  • 16

    Fuller GNRhee CHHess KRCaskey LSWang RBruner JM: Reactivation of insulin-like growth factor binding protein 2 expression in glioblastoma multiforme: a revelation by parallel gene expression profiling. Cancer Res 59:422842321999

  • 17

    Giles EDSingh G: Role of insulin-like growth factor binding proteins (IGFBPs) in breast cancer proliferation and metastasis. Clin Exp Metastasis 20:4814872003

  • 18

    Gouilleux-Gruart VGouilleux FDesaint CClaisse JFCapiod JCDelobel J: STAT-related transcription factors are constitutively activated in peripheral blood cells from acute leukemia patients. Blood 87:169216971996

  • 19

    Gui YMurphy LJ: Interaction of insulin-like growth factor binding protein-3 with latent transforming growth factor-beta binding protein-1. Mol Cell Biochem 250:1891952003

  • 20

    Haybaeck JObrist PSchindler CUSpizzo GDoppler W: STAT-1 expression in human glioblastoma and peritumoral tissue. Anticancer Res 27:6B382938352007

  • 21

    Hintz RLBock SThorsson AVBovens JPowell DRJakse G: Expression of the insulin like growth factor-binding protein 3 (IGFBP-3) gene is increased in human renal carcinomas. J Urol 146:116011631991

  • 22

    Hui ZTretiakova MZhang ZLi YWang XZhu JX: Radiosensitization by inhibiting STAT1 in renal cell carcinoma. Int J Radiat Oncol Biol Phys 73:2882952009

  • 23

    Jones JID'Ercole AJCamacho-Hubner CClemmons DR: Phosphorylation of insulin-like growth factor (IGF)-binding protein 1 in cell culture and in vivo: effects on affinity for IGF-I. Proc Natl Acad Sci U S A 88:748174851991

  • 24

    Ju HLi XLi HWang XWang HLi Y: Mediation of multiple pathways regulating cell proliferation, migration, and apoptosis in the human malignant glioma cell line U87MG via unphosphorylated STAT1. Laboratory investigation. J Neurosurg 118:123912472013

  • 25

    Kelley KMOh YGargosky SEGucev ZMatsumoto THwa V: Insulin-like growth factor-binding proteins (IGFBPs) and their regulatory dynamics. Int J Biochem Cell Biol 28:6196371996

  • 26

    Khodarev NNBeckett MLabay EDarga TRoizman BWeichselbaum RR: STAT1 is overexpressed in tumors selected for radioresistance and confers protection from radiation in transduced sensitive cells. Proc Natl Acad Sci U S A 101:171417192004

  • 27

    Khodarev NNMinn AJEfimova EVDarga TELabay EBeckett M: Signal transducer and activator of transcription 1 regulates both cytotoxic and prosurvival functions in tumor cells. Cancer Res 67:921492202007

  • 28

    Khodarev NNRoach PPitroda SPGolden DWBhayani MShao MY: STAT1 pathway mediates amplification of metastatic potential and resistance to therapy. PLoS ONE 4:e58212009

  • 29

    Kleihues PLouis DNScheithauer BWRorke LBReifenberger GBurger PC: The WHO classification of tumors of the nervous system. J Neuropathol Exp Neurol 61:2152292002

  • 30

    Kleihues PLouis DNWiestler ODBurger PCSchiethauer BWWHO grading of tumors of central nervous system. Louis DNOhgaki HWiestler ODCavenee WK: WHO Classification of Tumors of the Central Nervous System ed 4LyonIARC Press2007. 1011

  • 31

    Kovacic BStoiber DMoriggl RWeisz EOtt RGKreibich R: STAT1 acts as a tumor promoter for leukemia development. Cancer Cell 10:77872006

  • 32

    Kulkarni AThota BSrividya MRThennarasu KArivazhagan ASantosh V: Expression pattern and prognostic significance of IGFBP isoforms in anaplastic astrocytoma. Pathol Oncol Res 18:9619672012

  • 33

    Marinaro JANeumann GMRusso VCLeeding KSBach LA: O-glycosylation of insulin-like growth factor (IGF) binding protein-6 maintains high IGF-II binding affinity by decreasing binding to glycosaminoglycans and susceptibility to proteolysis. Eur J Biochem 267:537853862000

  • 34

    Martin JLWeenink SMBaxter RC: Insulin-like growth factor-binding protein-3 potentiates epidermal growth factor action in MCF-10A mammary epithelial cells. Involvement of p44/42 and p38 mitogen-activated protein kinases. J Biol Chem 278:296929762003

  • 35

    Massoner PColleselli DMatscheski APircher HGeley SJansen Dürr P: Novel mechanism of IGF-binding protein-3 action on prostate cancer cells: inhibition of proliferation, adhesion, and motility. Endocr Relat Cancer 16:7958082009

  • 36

    Mosmann T: Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 65:55631983

  • 37

    Natsuizaka MOhashi SWong GSAhmadi AKalman RABudo D: Insulin-like growth factor-binding protein-3 promotes transforming growth factor-beta1-mediated epithelial-to-mesenchymal transition and motility in transformed human esophageal cells. Carcinogenesis 31:134413532010

  • 38

    Oh SHLee OHSchroeder CPOh YWKe SCha HJ: Antimetastatic activity of insulin-like growth factor binding protein-3 in lung cancer is mediated by insulin-like growth factor-independent urokinase-type plasminogen activator inhibition. Mol Cancer Ther 5:268526952006

  • 39

    O'Shea JJGadina MSchreiber RD: Cytokine signaling in 2002: new surprises in the Jak/Stat pathway. Cell 109:SupplS121S1312002

  • 40

    Oy GFSlipicevic ADavidson BSolberg Faye RMaelandsmo GMFlørenes VA: Biological effects induced by insulinlike growth factor binding protein 3 (IGFBP-3) in malignant melanoma. Int J Cancer 126:3503612010

  • 41

    Ragel BTCouldwell WTGillespie DLJensen RL: Identification of hypoxia-induced genes in a malignant glioma cell line (U-251) by cDNA microarray analysis. Neurosurg Rev 30:1811872007

  • 42

    Rajah RValentinis BCohen P: Insulin-like growth factor (IGF)-binding protein-3 induces apoptosis and mediates the effects of transforming growth factor-beta1 on programmed cell death through a p53- and IGF-independent mechanism. J Biol Chem 272:12181121881997

  • 43

    Reddy SPBritto RVinnakota KAparna HSreepathi HKThota B: Novel glioblastoma markers with diagnostic and prognostic value identified through transcriptome analysis. Clin Cancer Res 14:297829872008

  • 44

    Riedemann JMacaulay VM: IGF1R signalling and its inhibition. Endocr Relat Cancer 13:Suppl 1S33S432006

  • 45

    Rosenfeld RGHwa VWilson EPlymate SROh Y: The insulin-like growth factor-binding protein superfamily. Growth Horm IGF Res 10:Suppl AS16S172000

  • 46

    Santosh VArivazhagan ASreekanthreddy PSrinivasan HThota BSrividya MR: Grade-specific expression of insulin-like growth factor-binding proteins-2, -3, and -5 in astrocytomas: IGFBP-3 emerges as a strong predictor of survival in patients with newly diagnosed glioblastoma. Cancer Epidemiol Biomarkers Prev 19:139914082010

  • 47

    Sheen-Chen SMHuang CCTang RPYang CHChou FFEng HL: Signal transducer and activator of transcription 1 in breast cancer: analysis with tissue microarray. Anticancer Res 27:4B248124862007

  • 48

    Sivaprasad UFleming JVerma PSHogan KADesury GCohick WS: Stimulation of insulin-like growth factor (IGF) binding protein-3 synthesis by IGF-I and transforming growth factor-alpha is mediated by both phosphatidylinositol-3 kinase and mitogen-activated protein kinase pathways in mammary epithelial cells. Endocrinology 145:421342212004

  • 49

    Spagnoli ATorello MNagalla SRHorton WAPattee PHwa V: Identification of STAT-1 as a molecular target of IGFBP-3 in the process of chondrogenesis. J Biol Chem 277:18860188672002

  • 50

    Sreekumar ANyati MKVarambally SBarrette TRGhosh DLawrence TS: Profiling of cancer cells using protein microarrays: discovery of novel radiation-regulated proteins. Cancer Res 61:758575932001

  • 51

    Stark GR: How cells respond to interferons revisited: from early history to current complexity. Cytokine Growth Factor Rev 18:4194232007

  • 52

    Takaoka MHarada HAndl CDOyama KNaomoto YDempsey KL: Epidermal growth factor receptor regulates aberrant expression of insulin-like growth factor-binding protein 3. Cancer Res 64:771177232004

  • 53

    Torng PLLee YCHuang CYYe JHLin YSChu YW: Insulin-like growth factor binding protein-3 (IGFBP-3) acts as an invasion-metastasis suppressor in ovarian endometrioid carcinoma. Oncogene 27:213721472008

  • 54

    Trojan JCloix JFArdourel MYChatel MAnthony DD: Insulin-like growth factor type I biology and targeting in malignant gliomas. Neuroscience 145:7958112007

  • 55

    Vincent AMFeldman EL: Control of cell survival by IGF signaling pathways. Growth Horm IGF Res 12:1931972002

  • 56

    Wang HFuller GNZhang WInsulin-like growth factors and insulin-like growth factor binding proteins in CNS tumors. Zhang WFuller GN: Genomic and Molecular Neuro-Oncology Sudbury, MAJones and Bartlett2004. 119130

  • 57

    Widschwendter ATonko-Geymayer SWelte TDaxenbichler GMarth CDoppler W: Prognostic significance of signal transducer and activator of transcription 1 activation in breast cancer. Clin Cancer Res 8:306530742002

  • 58

    Xi SDyer KFKimak MZhang QGooding WEChaillet JR: Decreased STAT1 expression by promoter methylation in squamous cell carcinogenesis. J Natl Cancer Inst 98:1811892006

  • 59

    Xi YNakajima GHamil TFodstad ORiker AJu J: Association of insulin-like growth factor binding protein-3 expression with melanoma progression. Mol Cancer Ther 5:307830842006

TrendMD

Cited By

Metrics

Metrics

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 268 268 26
PDF Downloads 184 184 14
EPUB Downloads 0 0 0

PubMed

Google Scholar